View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-7 (Length: 273)

Name: F9343-LTR4-TNT-insertion-7
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9343-LTR4-TNT-insertion-7
F9343-LTR4-TNT-insertion-7
[»] chr4 (1 HSPs)
chr4 (8-263)||(28892889-28893144)


Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 263
Target Start/End: Complemental strand, 28893144 - 28892889
Alignment:
8 gaaatatctgtagatggagcgacagaggcaattggcaagctcacactcacaaagaggagatcccaagttcgaacctaaataaccacaaaaaacgtcgaat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28893144 gaaatatctgtagatggagcgacagaggcaattggcaagctcacactcacaaagaggagatcccaagttcgaacctaaataaccacaaaaaacgtcgaat 28893045  T
108 actacgtgaggtagaccttgtagacaatacttattagttataatttctttcnnnnnnnnntacttattagttataatataactctttttatactatttgt 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||    
28893044 actacgtgaggtagaccttgtagacaatacttattagttataatttctttcaaaaaaaaatacttattagttataatataactctttttatactatttgt 28892945  T
208 atgatgcaaatacaagtgattttgtttttacaaaagaaaattatatcatttcatta 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28892944 atgatgcaaatacaagtgattttgtttttacaaaagaaaattatatcatttcatta 28892889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175521 times since January 2019
Visitors: 2677