View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-8 (Length: 459)

Name: F9343-LTR4-TNT-insertion-8
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9343-LTR4-TNT-insertion-8
F9343-LTR4-TNT-insertion-8
[»] chr1 (11 HSPs)
chr1 (9-449)||(4194801-4195241)
chr1 (362-449)||(29095599-29095686)
chr1 (359-449)||(16254889-16254979)
chr1 (359-449)||(20808982-20809072)
chr1 (359-449)||(31032771-31032861)
chr1 (359-449)||(34807971-34808061)
chr1 (50-93)||(4186137-4186180)
chr1 (359-449)||(24135790-24135878)
chr1 (361-449)||(34475934-34476022)
chr1 (419-449)||(7167458-7167488)
chr1 (359-449)||(42480156-42480246)
[»] chr5 (7 HSPs)
chr5 (359-450)||(37093985-37094076)
chr5 (359-449)||(3456787-3456877)
chr5 (360-449)||(228058-228147)
chr5 (359-449)||(4391919-4392009)
chr5 (359-449)||(32891209-32891299)
chr5 (359-401)||(40925918-40925960)
chr5 (360-446)||(41326523-41326609)
[»] chr3 (11 HSPs)
chr3 (359-449)||(31788340-31788430)
chr3 (359-449)||(521838-521928)
chr3 (359-449)||(20912202-20912292)
chr3 (359-449)||(36517549-36517639)
chr3 (359-446)||(51297099-51297186)
chr3 (359-449)||(1561329-1561419)
chr3 (359-449)||(23643053-23643143)
chr3 (359-449)||(50612948-50613038)
chr3 (359-449)||(34624550-34624640)
chr3 (359-449)||(52546777-52546867)
chr3 (359-449)||(38176463-38176553)
[»] chr2 (13 HSPs)
chr2 (359-449)||(25414948-25415038)
chr2 (359-449)||(14941061-14941152)
chr2 (375-449)||(35323565-35323639)
chr2 (359-449)||(35676351-35676441)
chr2 (359-449)||(2752707-2752797)
chr2 (359-449)||(3810343-3810433)
chr2 (359-449)||(13686028-13686118)
chr2 (359-449)||(28429316-28429406)
chr2 (359-449)||(19898954-19899044)
chr2 (359-401)||(28716391-28716433)
chr2 (359-413)||(29689294-29689348)
chr2 (359-449)||(42263866-42263956)
chr2 (363-413)||(45093227-45093277)
[»] chr4 (8 HSPs)
chr4 (359-449)||(23348187-23348280)
chr4 (359-429)||(4512237-4512307)
chr4 (359-449)||(24683111-24683201)
chr4 (359-449)||(26179284-26179374)
chr4 (359-449)||(37674074-37674164)
chr4 (359-449)||(41633252-41633342)
chr4 (363-446)||(30508980-30509063)
chr4 (359-449)||(18375465-18375554)
[»] chr8 (4 HSPs)
chr8 (359-449)||(36473123-36473213)
chr8 (359-401)||(1005672-1005714)
chr8 (359-449)||(39112683-39112773)
chr8 (359-411)||(15561988-15562040)
[»] chr7 (4 HSPs)
chr7 (359-449)||(22326893-22326983)
chr7 (359-449)||(27425827-27425917)
chr7 (362-449)||(23992027-23992114)
chr7 (361-443)||(25686406-25686488)
[»] chr6 (3 HSPs)
chr6 (359-449)||(12607134-12607224)
chr6 (359-449)||(7646848-7646938)
chr6 (359-445)||(29636994-29637080)
[»] scaffold0002 (1 HSPs)
scaffold0002 (359-449)||(492701-492791)


Alignment Details
Target: chr1 (Bit Score: 373; Significance: 0; HSPs: 11)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 9 - 449
Target Start/End: Complemental strand, 4195241 - 4194801
Alignment:
9 gtagatcttgccgtcaatggagatccatgcatcgccacgagtgttgtgtttttgaagttcttgcaatgaaatgtaggttggttttagcaacggttcagtt 108  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4195241 gtagatcttgccgtcaatggagatccatgcatcgccgcgagtgttgtgtttttgaagttcttgcaatgaaatgtaggttggttttagcaacggttcagtt 4195142  T
109 tgtgttaccattgtgtaaggtatagaggtttagagtgtgagaatgtgtgtgatgctttgagttgtttttgtagggagggaagtaagtaagaagtaatgat 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
4195141 tgtgttaccattgtgtaaggtatagaggtttagagtgtgagaatgtgtgtgatgctttgagttgtttttgtagggagggaagtaagtaggaagtaatgat 4195042  T
209 tttgtgacacattaggtggggacaggtcaatcaagtaaactaggccctactannnnnnnncattcatatnnnnnnnntaatactatcggtatctaataac 308  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||        |||||||||        |||||||||||||||||||||||    
4195041 tttgtgacacattaggtggggacaggtcaatcaggtaaactaggccctactattttttttcattcatataaaaaaaataatactatcggtatctaataac 4194942  T
309 tattcttttctatcttttagtatagataactcgattgatgagctaaaagattatttgttcacttcctatttttcagtcatatctctttgaattatggtaa 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4194941 tattcttttctatcttttagtatagataactcgattgatgagctaaaagattatttgttcacttcctatttttcagtcatatctctttgaattatggtaa 4194842  T
409 atagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||| | |||||||||||||||||||||||||||||||    
4194841 atagtatattgtgattgactgttctttattcttgaagaatt 4194801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 362 - 449
Target Start/End: Original strand, 29095599 - 29095686
Alignment:
362 tttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||||||||||| || | ||| ||||||| ||| |||||||   | ||||||| ||| |||||||||||||||||||    
29095599 tttgttcacttcctatttttcagccacacctccttgaattgtggcaaatagtgcattgtgattggctgctctttattcttgaagaatt 29095686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 16254979 - 16254889
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||| ||||| || | ||| || |||||||| |||||||   | ||||||| ||| |||||||||||||||||||    
16254979 ttatttgttcacttcctattattcagccacacctccttaaattatggcaaatagtgcattgtgattggctgatctttattcttgaagaatt 16254889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 20809072 - 20808982
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||| |||||||||||| ||||||| || ||||| ||||||| ||| ||||| |   | ||||||||||| |||||||||||||||||||    
20809072 ttattcgttcacttcctagttttcagccacatctccttgaattgtggcaaataatgcattgtgattgactgctctttattcttgaagaatt 20808982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 31032771 - 31032861
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||| ||||||||||| || | ||| ||||| | ||| |||||||   | ||||||||||| |||||||||||||||||||    
31032771 ttatttgttcactttctatttttcagccacacctccttgaactgtggcaaatagtgcattgtgattgactgatctttattcttgaagaatt 31032861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 34808061 - 34807971
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||| |||||||| |||||||||| || | ||| || ||||||| |||||||||  | ||||||||||| |||||||| ||||||||||    
34808061 ttatttattcacttcatatttttcagccacacctccttaaattatgataaatagtacattgtgattgactgctctttatttttgaagaatt 34807971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 4186180 - 4186137
Alignment:
50 tgttgtgtttttgaagttcttgcaatgaaatgtaggttggtttt 93  Q
    ||||||||||||| |||||||||| |||||||||||||||||||    
4186180 tgttgtgtttttggagttcttgcagtgaaatgtaggttggtttt 4186137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 24135878 - 24135790
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || | ||| ||||||| ||| |||| | |  | ||||||| ||| |||||||||||||||||||    
24135878 ttatttgttcacttcctatttttcagccacacctccttgaattgtggcaaattgca--ttgtgattggctgctctttattcttgaagaatt 24135790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 361 - 449
Target Start/End: Complemental strand, 34476022 - 34475934
Alignment:
361 atttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||| || | ||| |||||||  || | |||||   | ||||||| ||| |||||||||||||||||||    
34476022 atttgttcacttcctatttttcagccacacctccttgaattggggcagatagtgcattgtgattggctgctctttattcttgaagaatt 34475934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 449
Target Start/End: Original strand, 7167458 - 7167488
Alignment:
419 gtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||||||||    
7167458 gtgattgactgttctttattcttgaagaatt 7167488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 42480246 - 42480156
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||| |||| || ||||||||||| || | ||| ||||||| ||||||||| ||  | || |||||||| | |||||||||||||||||    
42480246 ttatttattcattttctatttttcagccacacctcattgaattgtggtaaataatacattgtaattgactgctatttattcttgaagaatt 42480156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 3e-18; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 359 - 450
Target Start/End: Original strand, 37093985 - 37094076
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaattg 450  Q
    ||||||||||||||||||||||||||||| | ||| ||||||| | | ||||||||    ||||||||||| ||||||||||||||||||||    
37093985 ttatttgttcacttcctatttttcagtcacacctccttgaattgttgcaaatagtacaatgtgattgactgctctttattcttgaagaattg 37094076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 3456877 - 3456787
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||||||||||||||||| | ||| ||||||| ||| |||||||   | |||| |||||| |||||||||||||||||||    
3456877 ttatttgttcacttcctatttttcagtcacacctccttgaattgtggcaaatagtgcattgtgagtgactgctctttattcttgaagaatt 3456787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 360 - 449
Target Start/End: Complemental strand, 228147 - 228058
Alignment:
360 tatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||| ||| |||||||||| | ||| ||||||| |||||||||||   | |||||||| ||||||||||||||||| ||||    
228147 tatttgttcactttctacttttcagtcacacctccttgaattgtggtaaatagtgcattgtgattgattgttctttattcttgaaaaatt 228058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 4391919 - 4392009
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || | ||| ||||||| ||| ||| |||   | || |||| ||| |||||||||||||||||||    
4391919 ttatttgttcacttcctatttttcagccacagctccttgaattgtggcaaacagtgcattgtaattggctgctctttattcttgaagaatt 4392009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 32891299 - 32891209
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||||||| ||| || || | ||| ||||||| ||| |||||||   | ||||||| ||| | |||||||||||||||||    
32891299 ttatttgttcacttcctatcttttagccacacctccttgaattgtggcaaatagtgcattgtgattggctgctttttattcttgaagaatt 32891209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 401
Target Start/End: Complemental strand, 40925960 - 40925918
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaatt 401  Q
    |||||||||||||||||||||||||| || | |||||||||||    
40925960 ttatttgttcacttcctatttttcagccacacctctttgaatt 40925918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 446
Target Start/End: Original strand, 41326523 - 41326609
Alignment:
360 tatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaaga 446  Q
    |||||||| |||||||||||||||| || | ||| ||||||| ||  |||||| |  | ||||||| ||| ||||||||||||||||    
41326523 tatttgtttacttcctatttttcagccacacctccttgaattgtgtcaaatagcacattgtgattggctgctctttattcttgaaga 41326609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 1e-17; HSPs: 11)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 31788430 - 31788340
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||||||||||||| ||| | ||| ||||||| |||||||||||   | ||||||| ||| |||||||||||||||||||    
31788430 ttatttgttcacttcctatttttcaatcacacctccttgaattgtggtaaatagtgcattgtgattggctgctctttattcttgaagaatt 31788340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 521838 - 521928
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || | ||| ||||||| ||| |||||||   | ||||||| ||| |||||||||||||||||||    
521838 ttatttgttcacttcctatttttcagccacacctccttgaattgtggcaaatagtgcattgtgattggctgctctttattcttgaagaatt 521928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 20912292 - 20912202
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||||||||||||||||| | ||| || |||||||  |||||||   | || |||||||| |||||||||||||||||||    
20912292 ttatttgttcacttcctatttttcagtcacacctccttaaattatgacaaatagtgcattgttattgactgctctttattcttgaagaatt 20912202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 36517639 - 36517549
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||||||||||| | ||| | ||| ||||||| ||| |||||||   | ||||||||||| |||||||||||||||||||    
36517639 ttatttgttcacttcctattttttattcacacctccttgaattgtggcaaatagtgcattgtgattgactgctctttattcttgaagaatt 36517549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 359 - 446
Target Start/End: Original strand, 51297099 - 51297186
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaaga 446  Q
    |||||||||||||| |||||||||||||||| || |||||||| ||| |||||||   | ||| ||| ||||||||||| ||||||||    
51297099 ttatttgttcactttctatttttcagtcatacctttttgaattgtggcaaatagtgcattgtggttggctgttctttatgcttgaaga 51297186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 1561329 - 1561419
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || | ||| ||||||| ||| |||||||   | |||||||  || |||||||||||||||||||    
1561329 ttatttgttcacttcctatttttcagccacacctccttgaattgtggcaaatagtgcattgtgattggttgctctttattcttgaagaatt 1561419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 23643053 - 23643143
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||||||||||| ||||| | ||| ||||||| ||| |||||||   | ||||||||||  | |||||||||||||||||    
23643053 ttatttgttcacttcctattttttagtcacacctccttgaattgtggcaaatagtgcattgtgattgactaatatttattcttgaagaatt 23643143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 50612948 - 50613038
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||  ||||||||||||| | ||| ||||||| ||| |||||||   | ||||||| ||| |||||||||||||||||||    
50612948 ttatttgttcactttatatttttcagtcacacctccttgaattgtggcaaatagtgcattgtgattggctgctctttattcttgaagaatt 50613038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 34624550 - 34624640
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || |  || |  |||| |||||||||||   | ||||||| ||| |||||||||||||||||||    
34624550 ttatttgttcacttcctatttttcagccacacttcctcaaattgtggtaaatagtgcattgtgattggctgctctttattcttgaagaatt 34624640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 52546867 - 52546777
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||| ||||||||||||| ||| | ||| ||||||| ||  |||||| |  | ||||||| ||| |||||||||||||||||||    
52546867 ttatttgttcatttcctatttttcactcacacctcattgaattgtgacaaatagcacattgtgattggctgctctttattcttgaagaatt 52546777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 38176463 - 38176553
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||| |||||||||| || | ||| |||||||  || |||||||   | | ||||| ||| |||||||||||||||||||    
38176463 ttatttgttcacttcatatttttcagccacacctccttgaattgaggcaaatagtgcattgcgattggctgctctttattcttgaagaatt 38176553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 13)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 25415038 - 25414948
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||| || |||||||| |||| ||| ||||||| ||| |||||||   | |||||||||||||||||||||||||||||||    
25415038 ttatttgttcactttctttttttcagccatacctccttgaattgtggcaaatagtgcattgtgattgactgttctttattcttgaagaatt 25414948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 14941061 - 14941152
Alignment:
359 ttatttgttcacttcctatttttc-agtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||| |||||||| ||||| | ||||||||||| ||| |||||||   | ||||||||||| |||||||||||||||||||    
14941061 ttatttgttcacttcttatttttcgagtcacacctctttgaattgtggcaaatagtgcattgtgattgactgctctttattcttgaagaatt 14941152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 375 - 449
Target Start/End: Original strand, 35323565 - 35323639
Alignment:
375 tatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||| || | ||| ||||||| ||| ||||||| | | |||||||||||||||||||||||||||||||    
35323565 tatttttcagccacacctcattgaattgtggcaaatagtgtattgtgattgactgttctttattcttgaagaatt 35323639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 35676351 - 35676441
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||| ||||||||||||| | ||| ||||||| ||| |||||||   | ||| ||||||| ||||||||||| |||||||    
35676351 ttatttgttcacttcatatttttcagtcacacctccttgaattgtggcaaatagtgcattgtggttgactgctctttattcttaaagaatt 35676441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 2752707 - 2752797
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||| |||||||| ||||||||||||| ||||| ||||||| ||| |||||||   | ||||||| ||| | ||| |||||||||||||    
2752707 ttatttattcacttcttatttttcagtcagatctccttgaattgtggcaaatagtgcattgtgattggctgctattttttcttgaagaatt 2752797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 3810343 - 3810433
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||| ||||||||||||| | ||| ||||||| ||| |||||||   | || |||| ||  |||||||||||||||||||    
3810343 ttatttgttcacttcttatttttcagtcacacctccttgaattgtggcaaatagtgcattgtaattggctactctttattcttgaagaatt 3810433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 13686118 - 13686028
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || | ||| ||||||| ||| || ||||   | ||||||| ||| |||||||||||||| ||||    
13686118 ttatttgttcacttcctatttttcagccacacctccttgaattgtggcaagtagtgcattgtgattggctgctctttattcttgaaaaatt 13686028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 28429406 - 28429316
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||| ||||||||||||| | ||| || |||||||| ||||| |   | ||| ||| ||| |||||||||||||||||||    
28429406 ttatttgttcacttcttatttttcagtcacacctccttaaattatggcaaataatgcattgtgtttggctgctctttattcttgaagaatt 28429316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 19899044 - 19898954
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||| |||||||  ||| ||| ||||||| ||  ||||| |   | ||||||| ||| |||||||||||||||||||    
19899044 ttatttgttcacttcctaattttcagcaatacctccttgaattgtgacaaataatgcattgtgattggctgctctttattcttgaagaatt 19898954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 401
Target Start/End: Original strand, 28716391 - 28716433
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaatt 401  Q
    |||||||||||||||||||||||||| || | |||||||||||    
28716391 ttatttgttcacttcctatttttcagccacacctctttgaatt 28716433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 413
Target Start/End: Original strand, 29689294 - 29689348
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagt 413  Q
    ||||| ||||||||||||||||||||||| | ||| ||||||||| | |||||||    
29689294 ttattagttcacttcctatttttcagtcaaacctccttgaattatagcaaatagt 29689348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 42263956 - 42263866
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||| |||||||||||||| || | ||| ||||||| ||  |||| ||   | ||||||| ||| |||||||||||||||||||    
42263956 ttatttgttcatttcctatttttcagccacacctccttgaattgtgacaaattgtgcattgtgattggctgctctttattcttgaagaatt 42263866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 413
Target Start/End: Original strand, 45093227 - 45093277
Alignment:
363 ttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagt 413  Q
    ||||| ||||||||||||||||||||| ||| ||||||| ||| |||||||    
45093227 ttgtttacttcctatttttcagtcatacctccttgaattgtggcaaatagt 45093277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 7e-16; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 23348187 - 23348280
Alignment:
359 ttatttgttcacttcct---atttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||   ||||||||| || | ||| ||||||||||||||||||| | | |||||||| |||||||||||||| |||||||    
23348187 ttatttgttcacttcctcctatttttcagccacacctccttgaattatggtaaatagtgtattgtgattgagtgttctttattcttaaagaatt 23348280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 359 - 429
Target Start/End: Original strand, 4512237 - 4512307
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactg 429  Q
    ||||||||| ||||||||||||||||||| ||||| ||||||| ||| ||||||||| | |||||||||||    
4512237 ttatttgtttacttcctatttttcagtcacatctccttgaattgtggcaaatagtatattgtgattgactg 4512307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 24683201 - 24683111
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||||||||||||||||||||| | ||   |||||| ||| |||||||   | ||||||| ||| |||||||||||||||||||    
24683201 ttatttgttcacttcctatttttcagtcacaccttcctgaattgtggcaaatagtgcattgtgattggctgctctttattcttgaagaatt 24683111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 26179284 - 26179374
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || | ||| ||||||| || ||||||||     ||||||| ||| |||||||||||||||||||    
26179284 ttatttgttcacttcctatttttcagccacacctccttgaattgtgttaaatagtgcactgtgattggctgctctttattcttgaagaatt 26179374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 37674074 - 37674164
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||| ||||  |||||||||| || | ||||||||||| | ||||||||||  | ||||||||||| |||||| ||||||||||||    
37674074 ttatttgttaactttttatttttcagccacacctctttgaattgtagtaaatagtacattgtgattgactgctctttagtcttgaagaatt 37674164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 41633342 - 41633252
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || | ||| ||||||| ||| || ||||   | ||||||| ||| |||||||||||||||||||    
41633342 ttatttgttcacttcctatttttcagccacacctccttgaattgtggcaagtagtgcattgtgattggctgctctttattcttgaagaatt 41633252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 363 - 446
Target Start/End: Complemental strand, 30509063 - 30508980
Alignment:
363 ttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaaga 446  Q
    ||||||| ||||||||||||||| | |||||| || |||  || ||||||| | | || |||||||| ||||||||||||||||    
30509063 ttgttcatttcctatttttcagttacatctctgtgtattgcggcaaatagtgtattgtaattgactgctctttattcttgaaga 30508980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 18375465 - 18375554
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||| ||||||| || | ||| ||||||| ||| |||||||   | ||||||||| |  ||||||||||||||||||    
18375465 ttatttgttcacttccta-ttttcagccacacctccttgaattgtggcaaatagtgcattgtgattgaccgcactttattcttgaagaatt 18375554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 36473123 - 36473213
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||| || | ||| || |||| ||  ||||||| |   ||||||||||| |||||||||||||||||||    
36473123 ttatttgttcacttcctatttttcagccacacctccttaaattgtgtcaaatagtgtactgtgattgactgctctttattcttgaagaatt 36473213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 401
Target Start/End: Complemental strand, 1005714 - 1005672
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaatt 401  Q
    ||||||||||||||||||||||||||||| | |||||| ||||    
1005714 ttatttgttcacttcctatttttcagtcacacctctttaaatt 1005672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 39112773 - 39112683
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||| ||||||||||| |  | ||| ||||||||||| |||||||   | |||||||  || |||||||| ||||||||||    
39112773 ttatttgttcactttctatttttcagccgcacctccttgaattatggcaaatagtgcattgtgattggttgctctttatttttgaagaatt 39112683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 411
Target Start/End: Original strand, 15561988 - 15562040
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaata 411  Q
    |||||||||||||||||||||||||| || | ||| ||||||| ||| |||||    
15561988 ttatttgttcacttcctatttttcagccacacctccttgaattgtggcaaata 15562040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 22326983 - 22326893
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||| |||||||||||||| | |||  |||||| ||| ||||||||  | ||||||||| | ||||| |||||||||||||    
22326983 ttatttgttcactttctatttttcagtcacacctccctgaattgtggcaaatagtacattgtgattgacggctctttcttcttgaagaatt 22326893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 27425827 - 27425917
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||||||||||||||  || | ||| ||||||| ||| ||||| |   | ||||||||||||||||||||||| |||||||    
27425827 ttatttgttcacttcctatttttcaaccacaactccttgaattgtggcaaataatgcattgtgattgactgttctttattctttaagaatt 27425917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 362 - 449
Target Start/End: Original strand, 23992027 - 23992114
Alignment:
362 tttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||| ||||||||||| || | ||| ||||||| ||| |||||||   | ||||| | ||| |||||||||||||||||||    
23992027 tttgttcactttctatttttcagccacacctccttgaattgtggcaaatagtgcattgtgataggctgctctttattcttgaagaatt 23992114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 443
Target Start/End: Complemental strand, 25686488 - 25686406
Alignment:
361 atttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttga 443  Q
    ||||||| |||||||||||| ||| || | ||| || |||| ||||||||||||  |  ||||||| ||||||||||||||||    
25686488 atttgtttacttcctattttccagccacacctccttaaattgtggtaaatagtacattatgattgattgttctttattcttga 25686406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 12607134 - 12607224
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    |||||||||||||| |||||||||||||| | ||| || |||| ||| |||||||     ||||||||||| |||||||||||||||||||    
12607134 ttatttgttcactttctatttttcagtcacacctccttaaattgtggcaaatagtgcactgtgattgactgctctttattcttgaagaatt 12607224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Original strand, 7646848 - 7646938
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||| ||||||||||||||||| |  || ||||||| ||| |||||||   | ||||||| ||| |||||||| || |||||||    
7646848 ttatttgttcatttcctatttttcagtcacacatccttgaattgtggcaaatagtgcattgtgattggctgctctttatttttaaagaatt 7646938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 445
Target Start/End: Complemental strand, 29637080 - 29636994
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaag 445  Q
    |||||||||||||| |||||||||||   || ||| ||| ||| ||| |||||||  || ||||||||||| |||||||||| ||||    
29637080 ttatttgttcactttctatttttcagctttacctccttgtattgtggcaaatagttagttgtgattgactgctctttattctagaag 29636994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 359 - 449
Target Start/End: Complemental strand, 492791 - 492701
Alignment:
359 ttatttgttcacttcctatttttcagtcatatctctttgaattatggtaaatagtatgtagtgattgactgttctttattcttgaagaatt 449  Q
    ||||||||||| |||||||||||||| || | ||| ||||||| ||  |||| ||   | ||||||| ||| |||||||||||||||||||    
492791 ttatttgttcatttcctatttttcagccacacctccttgaattgtgacaaattgtgcattgtgattggctgctctttattcttgaagaatt 492701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111592 times since January 2019
Visitors: 1375