View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-9 (Length: 346)

Name: F9343-LTR4-TNT-insertion-9
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9343-LTR4-TNT-insertion-9
[»] chr3 (1 HSPs)
chr3 (7-336)||(2411210-2411539)
[»] scaffold0393 (1 HSPs)
scaffold0393 (39-336)||(13623-13919)
[»] chr8 (2 HSPs)
chr8 (7-149)||(30598935-30599081)
chr8 (177-213)||(30599084-30599120)

Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 7 - 336
Target Start/End: Original strand, 2411210 - 2411539
7 agaaagatgaacaaagaataagaataaagacgaatgcaaagatggatgaagctatttcattttaataagtgattacataagttttttgggtgctatgata 106  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2411210 agaaagatgaacaaagaaaaagaataaagacgaatgcaaagatggatgaagctatttcattttaataagtgattacataagttttttgggtgctatgata 2411309  T
107 caccatgtagtgtaaaacatagtaaagatgttggattacatttaagattactaaaagctatatattttttgtatcaaagactgaaaaagaacactgctcc 206  Q
2411310 caccatgtagtgtaaaacatagtaaagatgttggattacatttaagattactaaaagctatatattttttgtatcaaagactgaaaaagaacactgctcc 2411409  T
207 cttcatagtccaccaccatctgtttttgatctggtagacatccctttgttgggtagagatgagatagtatctacactttgatagcagatttctgttttta 306  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2411410 cttcatagtccaccaccatctgtttttgatttggtagacatccctttgttgggtagagatgagatagtatctacactttgatagcagatttctgttttta 2411509  T
307 accttgctatcaaagtcaaatctaacatta 336  Q
2411510 accttgctatcaaagtcaaatctaacatta 2411539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0393 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: scaffold0393

Target: scaffold0393; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 39 - 336
Target Start/End: Original strand, 13623 - 13919
39 aatgcaaagatggatgaagctatttcattttaataagtgattacata-agttttttgggtgctatgatacaccatgtagtgtaaaacatagtaaagatgt 137  Q
    ||||||||||||||||||| | ||||||||||||||||||||||||  ||||||||||||| ||||||||||||||||||||||||||| ||||||||||    
13623 aatgcaaagatggatgaagttgtttcattttaataagtgattacatttagttttttgggtg-tatgatacaccatgtagtgtaaaacatcgtaaagatgt 13721  T
138 tggattacatttaagattactaaaagctatatattttttgtatcaaagactgaaaaagaacactgctcccttcatagtccaccaccatctg-tttttga- 235  Q
    |||||||||||||||||||||||||||||||||  |||   || |  ||   ||||| |||||| |||||||||||||| ||||||||||| |||||||     
13722 tggattacatttaagattactaaaagctatata--tttaagattactga---aaaaaaaacacttctcccttcatagtctaccaccatctgttttttgat 13816  T
236 tctggtagacatccctttgttgggtagagatgagatagtatctacactttgatagcagatttctg-tttttaaccttgctatcaaagtc-aaatctaaca 333  Q
    | ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||  ||||| ||||||||||||||||||||||| ||||||||||    
13817 tttggtagacatccctttgttgggtagagatgagacaatatctacacttcgatagcagtgttctgttttttaaccttgctatcaaagtcaaaatctaaca 13916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 7 - 149
Target Start/End: Original strand, 30598935 - 30599081
7 agaaagatgaacaaagaataagaataaagacgaatgcaaagatggatgaagctatttcattttaataagtgattacataagttttttgggtgctatgata 106  Q
    ||||||||||||||| || | ||| |||||  ||| ||| ||||||| ||||| |||||||||||||||||||||||||||||||||||| || ||||||    
30598935 agaaagatgaacaaataaaaggaaaaaagaaaaatacaatgatggataaagctgtttcattttaataagtgattacataagttttttgggcgcaatgata 30599034  T
107 ---caccatgtagtgt-aaaacatagtaaagatgttggattacattt 149  Q
       ||||||| |  || ||||||||||||||||||||||||||||||    
30599035 caccaccatgcaaagtaaaaacatagtaaagatgttggattacattt 30599081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 30599084 - 30599120
177 gtatcaaagactgaaaaagaacactgctcccttcata 213  Q
    ||||||||||||||||| |||||||||||||||||||    
30599084 gtatcaaagactgaaaatgaacactgctcccttcata 30599120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111577 times since January 2019
Visitors: 1375