View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-9 (Length: 346)

Name: F9343-LTR4-TNT-insertion-9
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9343-LTR4-TNT-insertion-9
F9343-LTR4-TNT-insertion-9
[»] chr3 (1 HSPs)
chr3 (7-336)||(2411210-2411539)
[»] scaffold0393 (1 HSPs)
scaffold0393 (39-336)||(13623-13919)
[»] chr8 (2 HSPs)
chr8 (7-149)||(30598935-30599081)
chr8 (177-213)||(30599084-30599120)


Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 7 - 336
Target Start/End: Original strand, 2411210 - 2411539
Alignment:
7 agaaagatgaacaaagaataagaataaagacgaatgcaaagatggatgaagctatttcattttaataagtgattacataagttttttgggtgctatgata 106  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2411210 agaaagatgaacaaagaaaaagaataaagacgaatgcaaagatggatgaagctatttcattttaataagtgattacataagttttttgggtgctatgata 2411309  T
107 caccatgtagtgtaaaacatagtaaagatgttggattacatttaagattactaaaagctatatattttttgtatcaaagactgaaaaagaacactgctcc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2411310 caccatgtagtgtaaaacatagtaaagatgttggattacatttaagattactaaaagctatatattttttgtatcaaagactgaaaaagaacactgctcc 2411409  T
207 cttcatagtccaccaccatctgtttttgatctggtagacatccctttgttgggtagagatgagatagtatctacactttgatagcagatttctgttttta 306  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2411410 cttcatagtccaccaccatctgtttttgatttggtagacatccctttgttgggtagagatgagatagtatctacactttgatagcagatttctgttttta 2411509  T
307 accttgctatcaaagtcaaatctaacatta 336  Q
    ||||||||||||||||||||||||||||||    
2411510 accttgctatcaaagtcaaatctaacatta 2411539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0393 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: scaffold0393
Description:

Target: scaffold0393; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 39 - 336
Target Start/End: Original strand, 13623 - 13919
Alignment:
39 aatgcaaagatggatgaagctatttcattttaataagtgattacata-agttttttgggtgctatgatacaccatgtagtgtaaaacatagtaaagatgt 137  Q
    ||||||||||||||||||| | ||||||||||||||||||||||||  ||||||||||||| ||||||||||||||||||||||||||| ||||||||||    
13623 aatgcaaagatggatgaagttgtttcattttaataagtgattacatttagttttttgggtg-tatgatacaccatgtagtgtaaaacatcgtaaagatgt 13721  T
138 tggattacatttaagattactaaaagctatatattttttgtatcaaagactgaaaaagaacactgctcccttcatagtccaccaccatctg-tttttga- 235  Q
    |||||||||||||||||||||||||||||||||  |||   || |  ||   ||||| |||||| |||||||||||||| ||||||||||| |||||||     
13722 tggattacatttaagattactaaaagctatata--tttaagattactga---aaaaaaaacacttctcccttcatagtctaccaccatctgttttttgat 13816  T
236 tctggtagacatccctttgttgggtagagatgagatagtatctacactttgatagcagatttctg-tttttaaccttgctatcaaagtc-aaatctaaca 333  Q
    | ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||  ||||| ||||||||||||||||||||||| ||||||||||    
13817 tttggtagacatccctttgttgggtagagatgagacaatatctacacttcgatagcagtgttctgttttttaaccttgctatcaaagtcaaaatctaaca 13916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 7 - 149
Target Start/End: Original strand, 30598935 - 30599081
Alignment:
7 agaaagatgaacaaagaataagaataaagacgaatgcaaagatggatgaagctatttcattttaataagtgattacataagttttttgggtgctatgata 106  Q
    ||||||||||||||| || | ||| |||||  ||| ||| ||||||| ||||| |||||||||||||||||||||||||||||||||||| || ||||||    
30598935 agaaagatgaacaaataaaaggaaaaaagaaaaatacaatgatggataaagctgtttcattttaataagtgattacataagttttttgggcgcaatgata 30599034  T
107 ---caccatgtagtgt-aaaacatagtaaagatgttggattacattt 149  Q
       ||||||| |  || ||||||||||||||||||||||||||||||    
30599035 caccaccatgcaaagtaaaaacatagtaaagatgttggattacattt 30599081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 30599084 - 30599120
Alignment:
177 gtatcaaagactgaaaaagaacactgctcccttcata 213  Q
    ||||||||||||||||| |||||||||||||||||||    
30599084 gtatcaaagactgaaaatgaacactgctcccttcata 30599120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 217023 times since January 2019
Visitors: 2908