View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-1 (Length: 697)

Name: F9350-LTR4-TNT-insertion-1
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9350-LTR4-TNT-insertion-1
[»] chr6 (3 HSPs)
chr6 (7-668)||(28961223-28961884)
chr6 (507-661)||(29000924-29001078)
chr6 (41-90)||(29001488-29001537)

Alignment Details
Target: chr6 (Bit Score: 581; Significance: 0; HSPs: 3)
Name: chr6

Target: chr6; HSP #1
Raw Score: 581; E-Value: 0
Query Start/End: Original strand, 7 - 668
Target Start/End: Complemental strand, 28961884 - 28961223
7 aatgaggacaagttttgcaacgcatataggcgtttccattctgcttgatttttgtgaagacgggttttgaaaaagatccattttgatgaattttaacagt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
28961884 aatgaggacaagttttgcaacgcatataggcgtttccattctgcttgatttttgtgaagatgggttttgaaaaagatccattttgatgaattttaacagt 28961785  T
107 tatattactagactcttgagaaaactcacaattgatactagaaaaggaaaggtaaaatggtcaagaaattgagtttctagggaaggaagttgtttatcaa 206  Q
28961784 tatattactagactcttgagaaaactcacaattgatactagaaaaggaaaggtaaaatggtcaagaaattgagtttctagggaaggaagttgtttatcaa 28961685  T
207 ccaagtatcatgtgttgaaaagaatgataagagaacagaaaattaaaagagagactaattaggaaattgttgttcagaaatcggacgcgaactaaatttt 306  Q
28961684 ccaagtatcatgtgttgaaaagaatgataagagaacagaaaattaaaagagagactaattaggaaattgttgttcagaaatcggacgcgaactaaatttt 28961585  T
307 agactgagttgcggactaggtcgtacagttcagctaaaggcttctaagttttgatactgaatatcaaattagaaggtttggtttttatagaagagagaga 406  Q
28961584 agactgagttgcggactaggtcgtacagttcagctaaaggcttctaagttttgatactgaatatcaaattagaaggtttggtttttatagaagagagaga 28961485  T
407 ataagaaacttgtgaagataaggttaggattattgaatnnnnnnnnggagagaaaacaagtgaaagatataaggnnnnnnnnnnnnnnnaaggtagagat 506  Q
    ||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||               |||||||||||    
28961484 ataagaaacttgtgaagataaggttaggattattgaataaaaaaaaggagagaaaacaagtgaaagatataaggttttttcttttttttaaggtagagat 28961385  T
507 agctttcaagtaccaatactttcaggtgctgcggctagaatgagatagagttaacataaattccataaatattgggaagggtgggtggtttatggagtat 606  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28961384 agctttcaagtaccaatactttcaggtgctgcggttagaatgagatagagttaacataaattccataaatattgggaagggtgggtggtttatggagtat 28961285  T
607 agagaggaccacatgggtcaagaagactccctcagatggggatttgaatgaagaacttacca 668  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
28961284 agagaggaccacatgggtcaagaagactccctcagatggggattttaatgaagaacttacca 28961223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 507 - 661
Target Start/End: Complemental strand, 29001078 - 29000924
507 agctttcaagtaccaatactttcaggtgctgcggctagaatgagatagagttaacataaattccataaatattgggaagggtgggtggtttatggagtat 606  Q
    ||||||||||||| | |  |||||||||||| || |||||||||||||||  || | |||||||||||||||||||||||||||||||||||| ||||||    
29001078 agctttcaagtactagtgttttcaggtgctgtggttagaatgagatagagccaagaaaaattccataaatattgggaagggtgggtggtttatagagtat 29000979  T
607 agagaggaccacatgggtcaagaagactccctcagatggggatttgaatgaagaa 661  Q
    ||||||||||||||| ||||||||||||||||||  |||||||||||||||||||    
29000978 agagaggaccacatgagtcaagaagactccctcaagtggggatttgaatgaagaa 29000924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 29001537 - 29001488
41 tccattctgcttgatttttgtgaagacgggttttgaaaaagatccatttt 90  Q
    ||||||||| |||||||| | ||||| |||||| ||||||||||||||||    
29001537 tccattctgtttgattttagagaagatgggtttcgaaaaagatccatttt 29001488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 31239 times since January 2019
Visitors: 1588