View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-1 (Length: 697)

Name: F9350-LTR4-TNT-insertion-1
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9350-LTR4-TNT-insertion-1
F9350-LTR4-TNT-insertion-1
[»] chr6 (3 HSPs)
chr6 (7-668)||(28961223-28961884)
chr6 (507-661)||(29000924-29001078)
chr6 (41-90)||(29001488-29001537)


Alignment Details
Target: chr6 (Bit Score: 581; Significance: 0; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 581; E-Value: 0
Query Start/End: Original strand, 7 - 668
Target Start/End: Complemental strand, 28961884 - 28961223
Alignment:
7 aatgaggacaagttttgcaacgcatataggcgtttccattctgcttgatttttgtgaagacgggttttgaaaaagatccattttgatgaattttaacagt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
28961884 aatgaggacaagttttgcaacgcatataggcgtttccattctgcttgatttttgtgaagatgggttttgaaaaagatccattttgatgaattttaacagt 28961785  T
107 tatattactagactcttgagaaaactcacaattgatactagaaaaggaaaggtaaaatggtcaagaaattgagtttctagggaaggaagttgtttatcaa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28961784 tatattactagactcttgagaaaactcacaattgatactagaaaaggaaaggtaaaatggtcaagaaattgagtttctagggaaggaagttgtttatcaa 28961685  T
207 ccaagtatcatgtgttgaaaagaatgataagagaacagaaaattaaaagagagactaattaggaaattgttgttcagaaatcggacgcgaactaaatttt 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28961684 ccaagtatcatgtgttgaaaagaatgataagagaacagaaaattaaaagagagactaattaggaaattgttgttcagaaatcggacgcgaactaaatttt 28961585  T
307 agactgagttgcggactaggtcgtacagttcagctaaaggcttctaagttttgatactgaatatcaaattagaaggtttggtttttatagaagagagaga 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28961584 agactgagttgcggactaggtcgtacagttcagctaaaggcttctaagttttgatactgaatatcaaattagaaggtttggtttttatagaagagagaga 28961485  T
407 ataagaaacttgtgaagataaggttaggattattgaatnnnnnnnnggagagaaaacaagtgaaagatataaggnnnnnnnnnnnnnnnaaggtagagat 506  Q
    ||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||               |||||||||||    
28961484 ataagaaacttgtgaagataaggttaggattattgaataaaaaaaaggagagaaaacaagtgaaagatataaggttttttcttttttttaaggtagagat 28961385  T
507 agctttcaagtaccaatactttcaggtgctgcggctagaatgagatagagttaacataaattccataaatattgggaagggtgggtggtttatggagtat 606  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28961384 agctttcaagtaccaatactttcaggtgctgcggttagaatgagatagagttaacataaattccataaatattgggaagggtgggtggtttatggagtat 28961285  T
607 agagaggaccacatgggtcaagaagactccctcagatggggatttgaatgaagaacttacca 668  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
28961284 agagaggaccacatgggtcaagaagactccctcagatggggattttaatgaagaacttacca 28961223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 507 - 661
Target Start/End: Complemental strand, 29001078 - 29000924
Alignment:
507 agctttcaagtaccaatactttcaggtgctgcggctagaatgagatagagttaacataaattccataaatattgggaagggtgggtggtttatggagtat 606  Q
    ||||||||||||| | |  |||||||||||| || |||||||||||||||  || | |||||||||||||||||||||||||||||||||||| ||||||    
29001078 agctttcaagtactagtgttttcaggtgctgtggttagaatgagatagagccaagaaaaattccataaatattgggaagggtgggtggtttatagagtat 29000979  T
607 agagaggaccacatgggtcaagaagactccctcagatggggatttgaatgaagaa 661  Q
    ||||||||||||||| ||||||||||||||||||  |||||||||||||||||||    
29000978 agagaggaccacatgagtcaagaagactccctcaagtggggatttgaatgaagaa 29000924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 29001537 - 29001488
Alignment:
41 tccattctgcttgatttttgtgaagacgggttttgaaaaagatccatttt 90  Q
    ||||||||| |||||||| | ||||| |||||| ||||||||||||||||    
29001537 tccattctgtttgattttagagaagatgggtttcgaaaaagatccatttt 29001488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175523 times since January 2019
Visitors: 2677