View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-11 (Length: 798)

Name: F9350-LTR4-TNT-insertion-11
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9350-LTR4-TNT-insertion-11
F9350-LTR4-TNT-insertion-11
[»] chr4 (3 HSPs)
chr4 (9-798)||(35924269-35925058)
chr4 (75-222)||(36200502-36200649)
chr4 (599-705)||(36200135-36200241)
[»] scaffold0064 (2 HSPs)
scaffold0064 (75-411)||(17997-18332)
scaffold0064 (593-701)||(18483-18591)
[»] chr5 (1 HSPs)
chr5 (76-156)||(18235186-18235266)


Alignment Details
Target: chr4 (Bit Score: 757; Significance: 0; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 757; E-Value: 0
Query Start/End: Original strand, 9 - 798
Target Start/End: Original strand, 35924269 - 35925058
Alignment:
9 gacatgtctatattttgtgctaatgaaaagaagctaaaaatattaaaaggaagaggatatactaatatacctgattagcaaatccaataccaaatcctag 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35924269 gacatgtctatattttgtgctaatgaaaagaagctaaaaatattaaaaggaagaggatatactaatatacctgattagcaaatccaataccaaatcctag 35924368  T
109 taatatccgaccaacgatcaacatccaaacgtgttgggcgaagccattaacaagggcaccaatgaggaacaataaacctccgaaaaacatggaaagtttc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
35924369 taatatccgaccaacgatcaacatccaaacgtgttgggcgaagccattaacaagggcaccaatgaggaacaataaacctccaaaaaacatggaaagtttc 35924468  T
209 cgaccaaacctacgggtgacactcgacgccaccagtgaagacaacaacgcggctaggtacaaggacgatgtaaacatcgttaggatctggctatcgtact 308  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35924469 cgaccaaacctacgggtgacactcgacgccaccagcgaagacaacaacgcggctaggtacaaggacgatgtaaacatcgttaggatctggctatcgtact 35924568  T
309 gacaatacttatttgatgacgtgcccaagtttttcttccgatacaccaatggaaaaaacttcaacagaaagggatccattgacgtcaccccacctaacca 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35924569 gacaatacttatttgatgacgtgcccaagtttttcttccgatacaccaatggaaaaaacttcaacagaaagggatccattgacgtcaccccacctaacca 35924668  T
409 aaattcatgcaatcaaatcaaatcaaaacacatacaataaactctatagttgtaaactatcgatttcagttgcaattatgacaacaatataaaagatgag 508  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35924669 aaattcatgcaatcaaatcaaatcaaaacacatacaataaactctatagttgtaaactatcgatttcagttgcaattatgacaacaatataaaagatgag 35924768  T
509 gtctctctacaacgatatcacagtcgcatggaccaactttacacgtattttattgcaattaaaggtttacaacgtaaccgcaactataaatatatacctg 608  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
35924769 gtctctctacaacgatatcacagtcgcatggaccaactttacacgtattttattgcaattaaaggtttacaacgtaactgcaactataaatatatacctg 35924868  T
609 aaattccaatatcgtagccgaagattaaacctcccattgctgcaacaatgcatgttacagtaacaaaaggagtgaggttgccggggtactccttgttgcc 708  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35924869 aaattccaatatcgtagccgaagattaaacctcccattgctgcaacaatgcatgttacagtaacaaaaggagtgaggttgccggggtactccttgttgcc 35924968  T
709 tccgccggtgggtattcctactgcaggcattttttgcttctcagnnnnnnnctgactttggtagagagagtgaagacctatagagattta 798  Q
    ||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||    
35924969 tccgccggtgggtattcctactgcaggcattttttgcttctcagtttttttctgactttggtagagagagtgaagacctatagagattta 35925058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 75 - 222
Target Start/End: Complemental strand, 36200649 - 36200502
Alignment:
75 atacctgattagcaaatccaataccaaatcctagtaatatccgaccaacgatcaacatccaaacgtgttgggcgaagccattaacaagggcaccaatgag 174  Q
    |||||||||||||||| || |||||||| || || || |||||||| ||||||||||||||||| || |  || |||||||||| ||| ||||| |  ||    
36200649 atacctgattagcaaacccgataccaaacccgagcaagatccgacccacgatcaacatccaaacatgattagcaaagccattaataagagcaccgacaag 36200550  T
175 gaacaataaacctccgaaaaacatggaaagtttccgaccaaacctacg 222  Q
    ||| | ||| |||||||||| |||||||||||||||||||||||||||    
36200549 gaaaagtaatcctccgaaaagcatggaaagtttccgaccaaacctacg 36200502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 599 - 705
Target Start/End: Complemental strand, 36200241 - 36200135
Alignment:
599 tatatacctgaaattccaatatcgtagccgaagattaaacctcccattgctgcaacaatgcatgttacagtaacaaaaggagtgaggttgccggggtact 698  Q
    ||||||||||||||||||||||||||||| ||||| ||||| ||||| || ||||| ||||||||||  || ||||||||||||||||| ||||||||||    
36200241 tatatacctgaaattccaatatcgtagccaaagatcaaaccacccatggcagcaacgatgcatgttatggtgacaaaaggagtgaggtttccggggtact 36200142  T
699 ccttgtt 705  Q
    | |||||    
36200141 ctttgtt 36200135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0064 (Bit Score: 81; Significance: 1e-37; HSPs: 2)
Name: scaffold0064
Description:

Target: scaffold0064; HSP #1
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 75 - 411
Target Start/End: Original strand, 17997 - 18332
Alignment:
75 atacctgattagcaaatccaataccaaatcctagtaatatccgaccaacgatcaacatccaaacgtgttgggcgaagccattaacaagggcaccaatgag 174  Q
    |||||||||| ||||| || |||||||| || || || |||||||||| ||||||||||||||| ||||| || ||||||||||  ||||| || |||||    
17997 atacctgattcgcaaacccgataccaaaaccaagaaagatccgaccaaggatcaacatccaaacatgttgagcaaagccattaatgagggctccgatgag 18096  T
175 gaacaataaacctccgaaaaacatggaaagtttccgaccaaacctacgggtgacactcgacgccaccagtgaagacaacaacgcggctaggtacaaggac 274  Q
    ||| |  | |||||| |||| ||| |||||||||||||||||| |||| || ||  | || ||||||| ||| ||||||| ||| || || ||||  |||    
18097 gaaaagcagacctccaaaaagcattgaaagtttccgaccaaacttacgagtcacggtggaagccaccaatgacgacaacagcgctgccagatacattgac 18196  T
275 gatgtaaacatcgttaggatctggctatcgtactgacaatacttatttgatgacgtgcccaagtttttcttccgatacaccaatggaaaaaacttcaaca 374  Q
    ||||| ||||||||||| ||||| |||||||| | |||||| |  ||||  |   |  ||||| |||||||||| || ||  |||| |||||||||||||    
18197 gatgtgaacatcgttagtatctgactatcgtatttacaatattggtttgtcgttctatccaag-ttttcttccggtaaactgatgggaaaaacttcaaca 18295  T
375 gaaagggatccattgacgtcaccccacctaaccaaaa 411  Q
     ||| |||||||| || || |||||||||||||||||    
18296 taaatggatccatggaagttaccccacctaaccaaaa 18332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0064; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 593 - 701
Target Start/End: Original strand, 18483 - 18591
Alignment:
593 tataaatatatacctgaaattccaatatcgtagccgaagattaaacctcccattgctgcaacaatgcatgttacagtaacaaaaggagtgaggttgccgg 692  Q
    |||| |||| ||||||||| ||||||||||||||||||||||||||| ||||| |||||||  ||||||||||| || ||||||| | ||||||| || |    
18483 tatatatatgtacctgaaactccaatatcgtagccgaagattaaaccacccatggctgcaaagatgcatgttacggtgacaaaagaaatgaggtttccag 18582  T
693 ggtactcct 701  Q
    |||||||||    
18583 ggtactcct 18591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 156
Target Start/End: Original strand, 18235186 - 18235266
Alignment:
76 tacctgattagcaaatccaataccaaatcctagtaatatccgaccaacgatcaacatccaaacgtgttgggcgaagccatt 156  Q
    ||||||||||||| |||||||||| ||||| ||||| || |||||||| || | ||||||||| | ||| || ||||||||    
18235186 tacctgattagcacatccaataccgaatccaagtaacatacgaccaacaatgagcatccaaacctcttgagcaaagccatt 18235266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 217170 times since January 2019
Visitors: 2908