View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-11 (Length: 798)

Name: F9350-LTR4-TNT-insertion-11
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9350-LTR4-TNT-insertion-11
[»] chr4 (3 HSPs)
chr4 (9-798)||(35924269-35925058)
chr4 (75-222)||(36200502-36200649)
chr4 (599-705)||(36200135-36200241)
[»] scaffold0064 (2 HSPs)
scaffold0064 (75-411)||(17997-18332)
scaffold0064 (593-701)||(18483-18591)
[»] chr5 (1 HSPs)
chr5 (76-156)||(18235186-18235266)

Alignment Details
Target: chr4 (Bit Score: 757; Significance: 0; HSPs: 3)
Name: chr4

Target: chr4; HSP #1
Raw Score: 757; E-Value: 0
Query Start/End: Original strand, 9 - 798
Target Start/End: Original strand, 35924269 - 35925058
9 gacatgtctatattttgtgctaatgaaaagaagctaaaaatattaaaaggaagaggatatactaatatacctgattagcaaatccaataccaaatcctag 108  Q
35924269 gacatgtctatattttgtgctaatgaaaagaagctaaaaatattaaaaggaagaggatatactaatatacctgattagcaaatccaataccaaatcctag 35924368  T
109 taatatccgaccaacgatcaacatccaaacgtgttgggcgaagccattaacaagggcaccaatgaggaacaataaacctccgaaaaacatggaaagtttc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
35924369 taatatccgaccaacgatcaacatccaaacgtgttgggcgaagccattaacaagggcaccaatgaggaacaataaacctccaaaaaacatggaaagtttc 35924468  T
209 cgaccaaacctacgggtgacactcgacgccaccagtgaagacaacaacgcggctaggtacaaggacgatgtaaacatcgttaggatctggctatcgtact 308  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35924469 cgaccaaacctacgggtgacactcgacgccaccagcgaagacaacaacgcggctaggtacaaggacgatgtaaacatcgttaggatctggctatcgtact 35924568  T
309 gacaatacttatttgatgacgtgcccaagtttttcttccgatacaccaatggaaaaaacttcaacagaaagggatccattgacgtcaccccacctaacca 408  Q
35924569 gacaatacttatttgatgacgtgcccaagtttttcttccgatacaccaatggaaaaaacttcaacagaaagggatccattgacgtcaccccacctaacca 35924668  T
409 aaattcatgcaatcaaatcaaatcaaaacacatacaataaactctatagttgtaaactatcgatttcagttgcaattatgacaacaatataaaagatgag 508  Q
35924669 aaattcatgcaatcaaatcaaatcaaaacacatacaataaactctatagttgtaaactatcgatttcagttgcaattatgacaacaatataaaagatgag 35924768  T
509 gtctctctacaacgatatcacagtcgcatggaccaactttacacgtattttattgcaattaaaggtttacaacgtaaccgcaactataaatatatacctg 608  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
35924769 gtctctctacaacgatatcacagtcgcatggaccaactttacacgtattttattgcaattaaaggtttacaacgtaactgcaactataaatatatacctg 35924868  T
609 aaattccaatatcgtagccgaagattaaacctcccattgctgcaacaatgcatgttacagtaacaaaaggagtgaggttgccggggtactccttgttgcc 708  Q
35924869 aaattccaatatcgtagccgaagattaaacctcccattgctgcaacaatgcatgttacagtaacaaaaggagtgaggttgccggggtactccttgttgcc 35924968  T
709 tccgccggtgggtattcctactgcaggcattttttgcttctcagnnnnnnnctgactttggtagagagagtgaagacctatagagattta 798  Q
    ||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||    
35924969 tccgccggtgggtattcctactgcaggcattttttgcttctcagtttttttctgactttggtagagagagtgaagacctatagagattta 35925058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 75 - 222
Target Start/End: Complemental strand, 36200649 - 36200502
75 atacctgattagcaaatccaataccaaatcctagtaatatccgaccaacgatcaacatccaaacgtgttgggcgaagccattaacaagggcaccaatgag 174  Q
    |||||||||||||||| || |||||||| || || || |||||||| ||||||||||||||||| || |  || |||||||||| ||| ||||| |  ||    
36200649 atacctgattagcaaacccgataccaaacccgagcaagatccgacccacgatcaacatccaaacatgattagcaaagccattaataagagcaccgacaag 36200550  T
175 gaacaataaacctccgaaaaacatggaaagtttccgaccaaacctacg 222  Q
    ||| | ||| |||||||||| |||||||||||||||||||||||||||    
36200549 gaaaagtaatcctccgaaaagcatggaaagtttccgaccaaacctacg 36200502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 599 - 705
Target Start/End: Complemental strand, 36200241 - 36200135
599 tatatacctgaaattccaatatcgtagccgaagattaaacctcccattgctgcaacaatgcatgttacagtaacaaaaggagtgaggttgccggggtact 698  Q
    ||||||||||||||||||||||||||||| ||||| ||||| ||||| || ||||| ||||||||||  || ||||||||||||||||| ||||||||||    
36200241 tatatacctgaaattccaatatcgtagccaaagatcaaaccacccatggcagcaacgatgcatgttatggtgacaaaaggagtgaggtttccggggtact 36200142  T
699 ccttgtt 705  Q
    | |||||    
36200141 ctttgtt 36200135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0064 (Bit Score: 81; Significance: 1e-37; HSPs: 2)
Name: scaffold0064

Target: scaffold0064; HSP #1
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 75 - 411
Target Start/End: Original strand, 17997 - 18332
75 atacctgattagcaaatccaataccaaatcctagtaatatccgaccaacgatcaacatccaaacgtgttgggcgaagccattaacaagggcaccaatgag 174  Q
    |||||||||| ||||| || |||||||| || || || |||||||||| ||||||||||||||| ||||| || ||||||||||  ||||| || |||||    
17997 atacctgattcgcaaacccgataccaaaaccaagaaagatccgaccaaggatcaacatccaaacatgttgagcaaagccattaatgagggctccgatgag 18096  T
175 gaacaataaacctccgaaaaacatggaaagtttccgaccaaacctacgggtgacactcgacgccaccagtgaagacaacaacgcggctaggtacaaggac 274  Q
    ||| |  | |||||| |||| ||| |||||||||||||||||| |||| || ||  | || ||||||| ||| ||||||| ||| || || ||||  |||    
18097 gaaaagcagacctccaaaaagcattgaaagtttccgaccaaacttacgagtcacggtggaagccaccaatgacgacaacagcgctgccagatacattgac 18196  T
275 gatgtaaacatcgttaggatctggctatcgtactgacaatacttatttgatgacgtgcccaagtttttcttccgatacaccaatggaaaaaacttcaaca 374  Q
    ||||| ||||||||||| ||||| |||||||| | |||||| |  ||||  |   |  ||||| |||||||||| || ||  |||| |||||||||||||    
18197 gatgtgaacatcgttagtatctgactatcgtatttacaatattggtttgtcgttctatccaag-ttttcttccggtaaactgatgggaaaaacttcaaca 18295  T
375 gaaagggatccattgacgtcaccccacctaaccaaaa 411  Q
     ||| |||||||| || || |||||||||||||||||    
18296 taaatggatccatggaagttaccccacctaaccaaaa 18332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0064; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 593 - 701
Target Start/End: Original strand, 18483 - 18591
593 tataaatatatacctgaaattccaatatcgtagccgaagattaaacctcccattgctgcaacaatgcatgttacagtaacaaaaggagtgaggttgccgg 692  Q
    |||| |||| ||||||||| ||||||||||||||||||||||||||| ||||| |||||||  ||||||||||| || ||||||| | ||||||| || |    
18483 tatatatatgtacctgaaactccaatatcgtagccgaagattaaaccacccatggctgcaaagatgcatgttacggtgacaaaagaaatgaggtttccag 18582  T
693 ggtactcct 701  Q
18583 ggtactcct 18591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 156
Target Start/End: Original strand, 18235186 - 18235266
76 tacctgattagcaaatccaataccaaatcctagtaatatccgaccaacgatcaacatccaaacgtgttgggcgaagccatt 156  Q
    ||||||||||||| |||||||||| ||||| ||||| || |||||||| || | ||||||||| | ||| || ||||||||    
18235186 tacctgattagcacatccaataccgaatccaagtaacatacgaccaacaatgagcatccaaacctcttgagcaaagccatt 18235266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111595 times since January 2019
Visitors: 1375