View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-2 (Length: 523)

Name: F9350-LTR4-TNT-insertion-2
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9350-LTR4-TNT-insertion-2
F9350-LTR4-TNT-insertion-2
[»] chr5 (7 HSPs)
chr5 (8-502)||(31932482-31932975)
chr5 (352-413)||(119008-119069)
chr5 (344-413)||(8750008-8750077)
chr5 (352-413)||(119989-120050)
chr5 (352-413)||(4187867-4187928)
chr5 (344-412)||(31588369-31588438)
chr5 (361-410)||(35294850-35294899)
[»] chr7 (16 HSPs)
chr7 (154-272)||(27310225-27310343)
chr7 (154-272)||(30939381-30939499)
chr7 (181-269)||(4153488-4153576)
chr7 (344-413)||(18152754-18152823)
chr7 (344-409)||(11974666-11974731)
chr7 (343-412)||(20543910-20543979)
chr7 (361-413)||(12933101-12933153)
chr7 (344-414)||(17075640-17075710)
chr7 (344-413)||(10466802-10466871)
chr7 (344-409)||(11975086-11975150)
chr7 (344-413)||(16755656-16755724)
chr7 (348-424)||(15878617-15878692)
chr7 (345-413)||(17075217-17075285)
chr7 (344-412)||(28854676-28854744)
chr7 (344-424)||(30939587-30939667)
chr7 (344-412)||(32092227-32092295)
[»] chr4 (9 HSPs)
chr4 (48-131)||(38680853-38680936)
chr4 (344-414)||(41510065-41510135)
chr4 (344-414)||(7118187-7118257)
chr4 (344-410)||(26168415-26168483)
chr4 (344-410)||(3296544-3296610)
chr4 (344-414)||(38759701-38759771)
chr4 (344-414)||(51906842-51906912)
chr4 (361-414)||(19310784-19310837)
chr4 (345-414)||(48553893-48553962)
[»] chr1 (9 HSPs)
chr1 (181-273)||(1500803-1500894)
chr1 (344-411)||(5683161-5683228)
chr1 (344-414)||(18180301-18180371)
chr1 (344-414)||(45664684-45664754)
chr1 (344-414)||(5172742-5172812)
chr1 (344-414)||(9880481-9880551)
chr1 (344-414)||(36793597-36793667)
chr1 (344-413)||(1501004-1501073)
chr1 (344-412)||(3591360-3591428)
[»] chr2 (13 HSPs)
chr2 (344-412)||(21182306-21182374)
chr2 (344-411)||(2191217-2191284)
chr2 (342-409)||(30311199-30311266)
chr2 (344-414)||(24093153-24093223)
chr2 (344-413)||(21217344-21217413)
chr2 (344-413)||(39600770-39600839)
chr2 (344-412)||(21264990-21265058)
chr2 (352-414)||(10708020-10708082)
chr2 (352-413)||(23222894-23222955)
chr2 (344-412)||(3691412-3691480)
chr2 (343-419)||(7083514-7083590)
chr2 (344-412)||(21216922-21216990)
chr2 (344-412)||(21265412-21265480)
[»] chr8 (12 HSPs)
chr8 (352-414)||(44803594-44803656)
chr8 (207-269)||(44000960-44001022)
chr8 (352-413)||(44802180-44802241)
chr8 (344-412)||(9800038-9800106)
chr8 (361-413)||(10047477-10047529)
chr8 (352-412)||(40304683-40304743)
chr8 (344-411)||(21006145-21006212)
chr8 (344-414)||(26720318-26720388)
chr8 (352-413)||(4694463-4694524)
chr8 (344-413)||(17914195-17914264)
chr8 (344-412)||(13315201-13315269)
chr8 (344-412)||(17915530-17915597)
[»] chr3 (14 HSPs)
chr3 (344-413)||(22814294-22814363)
chr3 (352-413)||(26741331-26741392)
chr3 (344-411)||(13637803-13637870)
chr3 (361-424)||(33226962-33227025)
chr3 (344-412)||(7248512-7248580)
chr3 (344-428)||(45728340-45728424)
chr3 (352-411)||(3799722-3799781)
chr3 (352-411)||(25770494-25770553)
chr3 (352-411)||(47343756-47343815)
chr3 (344-407)||(50732229-50732292)
chr3 (344-407)||(50780563-50780626)
chr3 (352-411)||(51505955-51506014)
chr3 (344-414)||(132082-132152)
chr3 (352-409)||(33225490-33225547)
[»] chr6 (7 HSPs)
chr6 (344-412)||(211440-211508)
chr6 (344-413)||(8710363-8710432)
chr6 (344-412)||(17157856-17157924)
chr6 (344-411)||(211744-211811)
chr6 (352-411)||(14712830-14712889)
chr6 (344-410)||(14713029-14713095)
chr6 (344-413)||(5974009-5974078)
[»] scaffold0063 (1 HSPs)
scaffold0063 (348-410)||(35219-35281)
[»] scaffold0177 (1 HSPs)
scaffold0177 (352-413)||(25873-25934)


Alignment Details
Target: chr5 (Bit Score: 420; Significance: 0; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 8 - 502
Target Start/End: Original strand, 31932482 - 31932975
Alignment:
8 atccttagatcaaaatcaacaggaagtaagaaaagggattaattgtttcttggaaatgtcggtgttggcttgcctgcattattgggaaatagaaaagctt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31932482 atccttagatcaaaatcaacaggaagtaagaaaagggattaattgtttcttggaaatgtcggtgttggcttgcctgcattattgggaaatagaaaagctt 31932581  T
108 atgccactgatgaacaaggttcatagctattgtcgaggctgatggtaaatggaggaggaagaagaaatgacatgaatttagggattgaaattcaaactca 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31932582 atgccactgatgaacaaggttcatagctattgtcgaggctgatggtaaatggaggaggaagaagaaatgacatgaatttagggattgaaattcaaactca 31932681  T
208 aatcggttggatccatgggtcggtttatttaacccatttcatttggcccaatccatttaaaaggacnnnnnnnnnnntaaaattgccacgtcaccttccc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           || ||||||||||||| ||||||    
31932682 aatcggttggatccatgggtcggtttatttaacccatttcatttggcccaatccatttaaaaggac-aaaaaaaaaatagaattgccacgtcagcttccc 31932780  T
308 atttggtgattggatgaaaattgacggcatggactaatttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatattt 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
31932781 atttggtgattggatgaaaattgacggcatggactaatttaataaaatgtagagactatttatcaaaggggcgcaaaatgtagggattgaaaacatattt 31932880  T
408 aacccttcattatattatattggttttacaacacatcaattnnnnnnntgtttgttgcatcgtctattacaactaaaaatgtattgtctcaattg 502  Q
    ||||||||||||||||||||||||||||| |||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||    
31932881 aacccttcattatattatattggttttacgacacatcaattaaaaaaatgtttgttgcatcgtctattacaactaaaaatgtattgtctcaattg 31932975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 352 - 413
Target Start/End: Complemental strand, 119069 - 119008
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||| |||||||||| ||||| | ||||||||||||||   |||||||||||||||||    
119069 aaatgtaaggactatttattaaaggagggcaaaatgtagggaccaaaaacatatttaaccct 119008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 344 - 413
Target Start/End: Complemental strand, 8750077 - 8750008
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||| |||||||  || ||||  |||||||||||||||||||| | ||| |||||||||||||||||    
8750077 atttaatgaaatgtagggattattattcaaaggggcgcaaaatgtaagaattaaaaacatatttaaccct 8750008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 352 - 413
Target Start/End: Original strand, 119989 - 120050
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||| |||||||| ||||||  | ||||||||||||||   |||||||||||||||||    
119989 aaatgtaaggactatttgtcaaagaagggcaaaatgtagggaccaaaaacatatttaaccct 120050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 352 - 413
Target Start/End: Original strand, 4187867 - 4187928
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||| |||||||  | ||||  |||||||||||||||| | |||||||||||||||||    
4187867 aaatgtaaggactattatttaaagttgcgcaaaatgtagggactaaaaacatatttaaccct 4187928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 412
Target Start/End: Original strand, 31588369 - 31588438
Alignment:
344 atttaataaaatgtaaagactatttatcaaagggg-cgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||  |||||||  ||||||||| ||||||||||| ||| | ||||||||||||||||    
31588369 atttaatgaaatgtagggactattcttcaaaggggacgcaaaatgtaaggactaaaaacatatttaaccc 31588438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 410
Target Start/End: Complemental strand, 35294899 - 35294850
Alignment:
361 gactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaac 410  Q
    |||||||||||||| | ||| |||||||||||| | ||||||||||||||    
35294899 gactatttatcaaaagagcgtaaaatgtagggactaaaaacatatttaac 35294850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 3e-34; HSPs: 16)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 154 - 272
Target Start/End: Complemental strand, 27310343 - 27310225
Alignment:
154 aaatggaggaggaagaagaaatgacatgaatttagggattgaaattcaaactcaaatcggttggatccatgggtcggtttatttaacccatttcatttgg 253  Q
    |||||||||| |||||||||||||||||||||| ||||||| |   |||||| |||| ||||| ||||||||||||| |||||| |||||||||||||||    
27310343 aaatggaggaagaagaagaaatgacatgaatttggggattggagaccaaactgaaatgggttgaatccatgggtcgggttattttacccatttcatttgg 27310244  T
254 cccaatccatttaaaagga 272  Q
    |||||||||||||||||||    
27310243 cccaatccatttaaaagga 27310225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 154 - 272
Target Start/End: Original strand, 30939381 - 30939499
Alignment:
154 aaatggaggaggaagaagaaatgacatgaatttagggattgaaattcaaactcaaatcggttggatccatgggtcggtttatttaacccatttcatttgg 253  Q
    |||| ||||| |||||||||||||||||||||| ||||||| ||| |||||| |||| ||||||||||||||||||| |||||| | |||||||||||||    
30939381 aaatagaggaagaagaagaaatgacatgaatttggggattggaatccaaactgaaatgggttggatccatgggtcgggttattttatccatttcatttgg 30939480  T
254 cccaatccatttaaaagga 272  Q
     ||||||||||||||||||    
30939481 tccaatccatttaaaagga 30939499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 181 - 269
Target Start/End: Original strand, 4153488 - 4153576
Alignment:
181 gaatttagggattgaaattcaaactcaaatcggttggatccatgggtcggtttatttaacccatttcatttggcccaatccatttaaaa 269  Q
    |||||||||||||| ||| |||||| |||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||    
4153488 gaatttagggattggaatccaaactgaaatgggttggatccatgggtcgggttattttacccatttcatttggcccaatccatttaaaa 4153576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 344 - 413
Target Start/End: Complemental strand, 18152823 - 18152754
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||| ||||||||  |||||||  |||||||||||||||||||| | | |||||||||||||||||||    
18152823 atttaacaaaatgtagggactattcttcaaaggggcgcaaaatgtaagaactgaaaacatatttaaccct 18152754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 344 - 409
Target Start/End: Complemental strand, 11974731 - 11974666
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaa 409  Q
    ||||||| ||||||| ||||||||| ||||||| |||||||||||| ||| | ||| |||||||||    
11974731 atttaatgaaatgtacagactatttttcaaaggagcgcaaaatgtaaggactaaaatcatatttaa 11974666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 343 - 412
Target Start/End: Complemental strand, 20543979 - 20543910
Alignment:
343 aatttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    |||||||| |||||||  |||||||  |||||||||| ||||||||| | ||| ||||||||||||||||    
20543979 aatttaatgaaatgtagggactattcttcaaaggggcacaaaatgtaagaattaaaaacatatttaaccc 20543910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 361 - 413
Target Start/End: Original strand, 12933101 - 12933153
Alignment:
361 gactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||||||||||||  | ||||||||||||| | |||||||||||||||||    
12933101 gactatttatcaaaggaacacaaaatgtagggactaaaaacatatttaaccct 12933153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 414
Target Start/End: Original strand, 17075640 - 17075710
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| |||||||  |||||||  |||||| ||||||||||||| ||| | |||| |||||||||||||    
17075640 atttaatgaaatgtagggactattcttcaaagaggcgcaaaatgtaaggactaaaaagatatttaaccctt 17075710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 413
Target Start/End: Original strand, 10466802 - 10466871
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||||||| || ||||||||  |||||  | |||||||||||  |||| |||||||||||||||||    
10466802 atttaataaaatatagagactattcttcaaatagacgcaaaatgtaaagattaaaaacatatttaaccct 10466871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 409
Target Start/End: Original strand, 11975086 - 11975150
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaa 409  Q
    ||||||||||| ||||||||||||| ||||||| || | ||||||| ||||| |||| ||||||||    
11975086 atttaataaaacgtaaagactatttttcaaaggagcac-aaatgtaaggattaaaaatatatttaa 11975150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 413
Target Start/End: Original strand, 16755656 - 16755724
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||| |||| || ||||||||  |||||| |||||||||| |||| ||| |||||||||||||||||    
16755656 atttaatgaaatatagagactattcttcaaagtggcgcaaaatatagg-attaaaaacatatttaaccct 16755724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 424
Target Start/End: Complemental strand, 15878692 - 15878617
Alignment:
348 aataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacccttcattatatta 424  Q
    ||||||||||| ||| ||||| || ||||| || ||||||||  |||| |||||||||||||||||| ||| |||||    
15878692 aataaaatgtatagattatttttcgaaggg-cgtaaaatgtaatgattaaaaacatatttaaccctttattttatta 15878617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 345 - 413
Target Start/End: Complemental strand, 17075285 - 17075217
Alignment:
345 tttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||| |||||||  |||||||  |||||| |||||||||| || ||| | |||||||||||||||||    
17075285 tttaatgaaatgtagggactattcttcaaagcggcgcaaaatataaggactaaaaacatatttaaccct 17075217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 412
Target Start/End: Complemental strand, 28854744 - 28854676
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    |||||||||||||||  || ||||  | ||| ||||||||||| || ||||| ||||||||||||||||    
28854744 atttaataaaatgtagggagtattctttaaatgggcgcaaaatataaggattaaaaacatatttaaccc 28854676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 424
Target Start/End: Original strand, 30939587 - 30939667
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacccttcattatatta 424  Q
    ||||||| |||||||  |||||||  || ||  |||| |||||||||||| | |||||||||||||||||| | |||||||    
30939587 atttaatgaaatgtagggactattcttcgaaatggcgtaaaatgtagggactaaaaacatatttaacccttaaatatatta 30939667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 412
Target Start/End: Complemental strand, 32092295 - 32092227
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| ||||| |  |||||||  |||||| ||||||||||||| ||| | ||||||||||||||||    
32092295 atttaatgaaatgcagggactattcttcaaagaggcgcaaaatgtaaggactaaaaacatatttaaccc 32092227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 48 - 131
Target Start/End: Complemental strand, 38680936 - 38680853
Alignment:
48 aattgtttcttggaaatgtcggtgttggcttgcctgcattattgggaaatagaaaagcttatgccactgatgaacaaggttcat 131  Q
    ||||||| |||||||||||||||||||| ||||| ||||||||||||||| ||| |||||||||  ||||||||||||| ||||    
38680936 aattgttgcttggaaatgtcggtgttggtttgccggcattattgggaaatggaacagcttatgctgctgatgaacaagggtcat 38680853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 344 - 414
Target Start/End: Complemental strand, 41510135 - 41510065
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    |||||||||||||||  |||||||  |||||||||||||||||||| ||||| |||| |||||||||||||    
41510135 atttaataaaatgtagggactattcttcaaaggggcgcaaaatgtaaggattaaaaatatatttaaccctt 41510065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 344 - 414
Target Start/End: Original strand, 7118187 - 7118257
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| |||||||  |||||||  |||||||||||||||||||| ||| | ||||||||||||||||||    
7118187 atttaatgaaatgtatggactattcttcaaaggggcgcaaaatgtaaggactaaaaacatatttaaccctt 7118257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 344 - 410
Target Start/End: Original strand, 26168415 - 26168483
Alignment:
344 atttaataaaatgta--aagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaac 410  Q
    |||||||||||||||  | |||||||   ||||||||||||||||||| ||||| ||||||||||||||    
26168415 atttaataaaatgtaggaggactattctacaaaggggcgcaaaatgtaaggattaaaaacatatttaac 26168483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 410
Target Start/End: Complemental strand, 3296610 - 3296544
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaac 410  Q
    ||||||| |||||||  || ||||  |||||||||||||||||||| ||| | ||||||||||||||    
3296610 atttaatgaaatgtagggaatattcttcaaaggggcgcaaaatgtaaggactaaaaacatatttaac 3296544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 414
Target Start/End: Complemental strand, 38759771 - 38759701
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| ||||||| ||||||||  |||||| |||||||||| || ||| | |||| |||||||||||||    
38759771 atttaatgaaatgtatagactattcttcaaagaggcgcaaaatttaaggactaaaaaaatatttaaccctt 38759701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 414
Target Start/End: Original strand, 51906842 - 51906912
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| | |||||  |||||||  ||||||| |||||||||||| ||| | ||||||||||||||||||    
51906842 atttaatgagatgtagggactattcttcaaaggagcgcaaaatgtaaggactaaaaacatatttaaccctt 51906912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 414
Target Start/End: Complemental strand, 19310837 - 19310784
Alignment:
361 gactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    |||||||  |||||| ||||||||||||| ||| | ||||||||||||||||||    
19310837 gactattcttcaaagaggcgcaaaatgtaaggactaaaaacatatttaaccctt 19310784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 345 - 414
Target Start/End: Complemental strand, 48553962 - 48553893
Alignment:
345 tttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    |||||| |||||||  |||||||  |||||||| ||||||||||| ||| | ||||| ||||||||||||    
48553962 tttaatgaaatgtatggactattcttcaaagggacgcaaaatgtaaggactaaaaacgtatttaaccctt 48553893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 8e-19; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 181 - 273
Target Start/End: Original strand, 1500803 - 1500894
Alignment:
181 gaatttagggattgaaattcaaactcaaatcggttggatccatgggtcggtttatttaacccatttcatttggcccaatccatttaaaaggac 273  Q
    |||||||||||||| ||| |||| | |||| ||||||||||||||||||| |||   |||| |||||||||||||||||||||||||||||||    
1500803 gaatttagggattggaatccaaattgaaatgggttggatccatgggtcgggttaaaaaacc-atttcatttggcccaatccatttaaaaggac 1500894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 344 - 411
Target Start/End: Complemental strand, 5683228 - 5683161
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    ||||||| |||||||  |||||||| |||||| | ||||||||||| ||||| |||||||||||||||    
5683228 atttaatgaaatgtagggactatttttcaaagagacgcaaaatgtaaggattaaaaacatatttaacc 5683161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 344 - 414
Target Start/End: Original strand, 18180301 - 18180371
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    |||||||||||||||  |||||||  |||||| |||||||||| ||  |||| ||||||||||||||||||    
18180301 atttaataaaatgtatggactattcttcaaagtggcgcaaaatataaagattaaaaacatatttaaccctt 18180371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 344 - 414
Target Start/End: Complemental strand, 45664754 - 45664684
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||| ||||||||| ||||||||  ||||| | ||| |||||||||||| | ||||||||||||||||||    
45664754 atttattaaaatgtagagactattcttcaaatgagcgtaaaatgtagggactaaaaacatatttaaccctt 45664684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 414
Target Start/End: Complemental strand, 5172812 - 5172742
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| ||||||| ||||||||  ||||| | |||||||||||| | | | ||||||||||||||||||    
5172812 atttaatgaaatgtagagactattcttcaaatgagcgcaaaatgtaagaactaaaaacatatttaaccctt 5172742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 414
Target Start/End: Complemental strand, 9880551 - 9880481
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| ||||||| ||||| ||  ||||||||  |||||||||| ||| | ||||||||||||||||||    
9880551 atttaatgaaatgtagagacttttcttcaaagggatgcaaaatgtaaggactaaaaacatatttaaccctt 9880481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 414
Target Start/End: Original strand, 36793597 - 36793667
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||| ||||||||| ||||||||  ||||||   |||||||| |||||| | ||||||||||||||||||    
36793597 atttattaaaatgtagagactattcttcaaagtcacgcaaaatatagggactaaaaacatatttaaccctt 36793667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 413
Target Start/End: Original strand, 1501004 - 1501073
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||| |||||||  |||||||  ||||| | ||||||||| |||||| | |||||||||||||||||    
1501004 atttaatgaaatgtagggactattcttcaaaagagcgcaaaatatagggactaaaaacatatttaaccct 1501073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 412
Target Start/End: Original strand, 3591360 - 3591428
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    |||||||||||||||  |||||||  ||||| | |||||||||||| ||| | |||| |||||||||||    
3591360 atttaataaaatgtatggactattcttcaaatgagcgcaaaatgtaaggactaaaaatatatttaaccc 3591428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 13)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 412
Target Start/End: Complemental strand, 21182374 - 21182306
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||| |||||||  |||||||||||||||||||| ||| | ||||||||||||||||    
21182374 atttaatgaaatgtaaggactattcttcaaaggggcgcaaaatgtaaggactaaaaacatatttaaccc 21182306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 411
Target Start/End: Complemental strand, 2191284 - 2191217
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    ||||||| |||||||| |||||||  |||||||||||||||||||| ||| | |||||||||||||||    
2191284 atttaatgaaatgtaaggactattcttcaaaggggcgcaaaatgtaaggactaaaaacatatttaacc 2191217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 342 - 409
Target Start/End: Complemental strand, 30311266 - 30311199
Alignment:
342 taatttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaa 409  Q
    |||||||||||||||||| |||||||| ||||| | | |||||||||| |||  ||||||||||||||    
30311266 taatttaataaaatgtaaggactatttttcaaatgagtgcaaaatgtaaggaccgaaaacatatttaa 30311199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 344 - 414
Target Start/End: Complemental strand, 24093223 - 24093153
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| |||||||  |||||||  ||||||||||||||| |||| ||| | ||||||||||||||||||    
24093223 atttaatgaaatgtagggactattcttcaaaggggcgcaaagtgtaaggactaaaaacatatttaaccctt 24093153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 344 - 413
Target Start/End: Original strand, 21217344 - 21217413
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||| |||||||  |||||||  |||||| ||||||||||||| ||| | |||||||||||||||||    
21217344 atttaatgaaatgtagggactattcttcaaagcggcgcaaaatgtaaggactaaaaacatatttaaccct 21217413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 344 - 413
Target Start/End: Complemental strand, 39600839 - 39600770
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||| ||||||||||||||||  |  ||| | ||||||||||| ||||| |||||||||||||||||    
39600839 atttaatgaaatgtaaagactattctttcaagagacgcaaaatgtaaggattaaaaacatatttaaccct 39600770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 412
Target Start/End: Complemental strand, 21265058 - 21264990
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||  |||||||  |||||| ||||||||||||| ||| | ||||||||||||||||    
21265058 atttaatgaaatgtagggactattcttcaaagcggcgcaaaatgtaaggactaaaaacatatttaaccc 21264990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 352 - 414
Target Start/End: Complemental strand, 10708082 - 10708020
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    |||||||| |||||||| ||||| | | ||||||||||||||   ||||||||||||||||||    
10708082 aaatgtaaggactatttgtcaaaagagggcaaaatgtagggaccaaaaacatatttaaccctt 10708020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 352 - 413
Target Start/End: Original strand, 23222894 - 23222955
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||| |||||||  | ||||  |||||||||||||||| | |||||||||||||||||    
23222894 aaatgtaaggactattatttaaagttgcgcaaaatgtagggactaaaaacatatttaaccct 23222955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 412
Target Start/End: Original strand, 3691412 - 3691480
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||  |||||||  |||||||||||||||||  | ||| | ||||||||||||||||    
3691412 atttaatgaaatgtagggactattcttcaaaggggcgcaaaatacaaggactaaaaacatatttaaccc 3691480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 343 - 419
Target Start/End: Complemental strand, 7083590 - 7083514
Alignment:
343 aatttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacccttcatta 419  Q
    |||||||| |||||||  |||||||  ||||| || || |||||||| ||||| |||||||||||| ||||| ||||    
7083590 aatttaatgaaatgtagggactattcttcaaatggacgtaaaatgtaaggattaaaaacatatttagcccttaatta 7083514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 412
Target Start/End: Complemental strand, 21216990 - 21216922
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||  |||||||  |||||| ||||||||||||| ||| | |||| |||||||||||    
21216990 atttaatgaaatgtagggactattcttcaaagaggcgcaaaatgtaaggactaaaaagatatttaaccc 21216922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 412
Target Start/End: Original strand, 21265412 - 21265480
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||  |||||||  |||||| ||||||||||||| ||| | |||| |||||||||||    
21265412 atttaatgaaatgtagggactattcttcaaagaggcgcaaaatgtaaggactaaaaagatatttaaccc 21265480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 12)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 352 - 414
Target Start/End: Original strand, 44803594 - 44803656
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    |||||||  |||||||||||||||| |||||||||||||||| | || |||||||||||||||    
44803594 aaatgtagggactatttatcaaaggagcgcaaaatgtagggactaaacacatatttaaccctt 44803656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 207 - 269
Target Start/End: Complemental strand, 44001022 - 44000960
Alignment:
207 aaatcggttggatccatgggtcggtttatttaacccatttcatttggcccaatccatttaaaa 269  Q
    |||| ||||||||||||||||||  || ||| ||||||||||||| | |||||||||||||||    
44001022 aaatgggttggatccatgggtcgagttgttttacccatttcattttgtccaatccatttaaaa 44000960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 352 - 413
Target Start/End: Complemental strand, 44802241 - 44802180
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||  |||||||||||||| | ||||||||||| |||| | |||||||||||||||||    
44802241 aaatgtatggactatttatcaaatgagcgcaaaatgttgggactaaaaacatatttaaccct 44802180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 412
Target Start/End: Complemental strand, 9800106 - 9800038
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    |||||||||||||||| || ||||  |||||| |||||||||| || ||| | ||||||||||||||||    
9800106 atttaataaaatgtaaggattattcttcaaagaggcgcaaaatctaaggactaaaaacatatttaaccc 9800038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 361 - 413
Target Start/End: Complemental strand, 10047529 - 10047477
Alignment:
361 gactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||  ||||| |||||||||||||| ||||| |||||||||||||||||    
10047529 gactattcttcaaaagggcgcaaaatgtaaggattaaaaacatatttaaccct 10047477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 352 - 412
Target Start/End: Complemental strand, 40304743 - 40304683
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    |||||||  |||||||||||||||| | |||||||||||||| | |||| |||||||||||    
40304743 aaatgtatggactatttatcaaaggagtgcaaaatgtagggactaaaaatatatttaaccc 40304683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 411
Target Start/End: Original strand, 21006145 - 21006212
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    |||||||||||||||  |||||||| ||||||||||  |||||||| ||| |  ||||||||||||||    
21006145 atttaataaaatgtagggactatttttcaaaggggccaaaaatgtaaggagtataaacatatttaacc 21006212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 414
Target Start/End: Complemental strand, 26720388 - 26720318
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| |||||||  |||||||  ||||||| |||||||||||||||| | |||| |||||||| ||||    
26720388 atttaatgaaatgtagggactattcttcaaaggagcgcaaaatgtagggactaaaaatatatttaatcctt 26720318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 352 - 413
Target Start/End: Original strand, 4694463 - 4694524
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||  |||||||||||||| | ||| ||||| |||||| | |||||||||||||||||    
4694463 aaatgtagggactatttatcaaaagagcgtaaaatatagggactaaaaacatatttaaccct 4694524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 413
Target Start/End: Complemental strand, 17914264 - 17914195
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||||||||||  |||||||  |||||| | |||||||||||  || | |||||||||||||||||    
17914264 atttaataaaatgtagggactattcttcaaagagacgcaaaatgtaaagacttaaaacatatttaaccct 17914195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 412
Target Start/End: Complemental strand, 13315269 - 13315201
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||  |||||||  | ||| |||||||||||||| ||| | ||||||||||||||||    
13315269 atttaatgaaatgtagggactattctttaaatgggcgcaaaatgtaaggactaaaaacatatttaaccc 13315201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 412
Target Start/End: Original strand, 17915530 - 17915597
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    |||||||||||||||| || ||||  ||||||| || ||||||||| ||| | ||||||||||||||||    
17915530 atttaataaaatgtaagga-tattcttcaaaggagcacaaaatgtaaggactaaaaacatatttaaccc 17915597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000003; HSPs: 14)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 344 - 413
Target Start/End: Complemental strand, 22814363 - 22814294
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||| |||||||  |||||||  |||||||||||||||||||| | ||| |||||||||||||||||    
22814363 atttaatgaaatgtatggactattcttcaaaggggcgcaaaatgtaagaattaaaaacatatttaaccct 22814294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 352 - 413
Target Start/End: Original strand, 26741331 - 26741392
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||||||||||||  |||||||||||||||| ||| ||| | |||||||||||||||||    
26741331 aaatgtaaagactattcttcaaaggggcgcaaaacgtaaggacttaaaacatatttaaccct 26741392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 344 - 411
Target Start/End: Original strand, 13637803 - 13637870
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    ||||||| ||||||| ||||||||  |||||||||||||||||||| ||| |  ||||||||||||||    
13637803 atttaatgaaatgtagagactattcttcaaaggggcgcaaaatgtaaggactagaaacatatttaacc 13637870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 361 - 424
Target Start/End: Original strand, 33226962 - 33227025
Alignment:
361 gactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacccttcattatatta 424  Q
    |||||||||||||||| |||||||||||||||| | | |||||||||||| ||| || ||||||    
33226962 gactatttatcaaaggagcgcaaaatgtagggactaagaacatatttaacacttaataatatta 33227025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 412
Target Start/End: Original strand, 7248512 - 7248580
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||| |||||||| | |||||||| | ||||||  | |||||||||||||| ||||||||||||||||    
7248512 atttattaaaatgtgaggactattttttaaagggaggtaaaatgtagggattaaaaacatatttaaccc 7248580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 428
Target Start/End: Original strand, 45728340 - 45728424
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacccttcattatattatatt 428  Q
    ||||||| |||||||  |||||||  |||||||| | ||||||||| ||| | |||||||||||||||||| ||| | |||||||    
45728340 atttaatgaaatgtatggactattcttcaaagggacacaaaatgtaaggactaaaaacatatttaacccttaatttttttatatt 45728424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 352 - 411
Target Start/End: Complemental strand, 3799781 - 3799722
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    ||||||| ||||||||||||||| | ||| |||||||||||| | |||| ||||||||||    
3799781 aaatgtagagactatttatcaaaagagcgtaaaatgtagggactaaaaagatatttaacc 3799722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 352 - 411
Target Start/End: Complemental strand, 25770553 - 25770494
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    ||||||||||||||||| |||||    ||||||||||| ||||| |||||||||||||||    
25770553 aaatgtaaagactatttttcaaaatcacgcaaaatgtaaggattaaaaacatatttaacc 25770494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 352 - 411
Target Start/End: Original strand, 47343756 - 47343815
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    ||||||| ||||||||||||||| |  || |||||||||||| |||||| ||||||||||    
47343756 aaatgtagagactatttatcaaaagaacgtaaaatgtagggactgaaaagatatttaacc 47343815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 407
Target Start/End: Complemental strand, 50732292 - 50732229
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatattt 407  Q
    ||||||| |||||||  |||||||| ||||||| |||||||||||| ||||  |||||||||||    
50732292 atttaatgaaatgtatggactatttttcaaaggagcgcaaaatgtaaggataaaaaacatattt 50732229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 407
Target Start/End: Original strand, 50780563 - 50780626
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatattt 407  Q
    ||||||| |||||||  |||||||| ||||||| |||||||||||| ||||  |||||||||||    
50780563 atttaatgaaatgtatggactatttttcaaaggagcgcaaaatgtaaggataaaaaacatattt 50780626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 352 - 411
Target Start/End: Complemental strand, 51506014 - 51505955
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    |||||||  |||||||||||||| | ||| |||||||||||||| |||| ||||||||||    
51506014 aaatgtagggactatttatcaaaagagcgtaaaatgtagggattaaaaatatatttaacc 51505955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 414
Target Start/End: Original strand, 132082 - 132152
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccctt 414  Q
    ||||||| |||||||| |||||||  ||||||| | |||||||||| ||| | || |||||||||||||||    
132082 atttaatgaaatgtaaggactattcttcaaaggagtgcaaaatgtaaggactaaatacatatttaaccctt 132152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 352 - 409
Target Start/End: Complemental strand, 33225547 - 33225490
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaa 409  Q
    |||||||  |||||||||||||||| ||| ||||||||| || | |||||||||||||    
33225547 aaatgtagggactatttatcaaaggagcgtaaaatgtagagactaaaaacatatttaa 33225490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 7)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 412
Target Start/End: Complemental strand, 211508 - 211440
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||  |||||||  |||||||||||||||||||| ||| | ||||||||||||||||    
211508 atttaatgaaatgtacggactattcttcaaaggggcgcaaaatgtaaggactaaaaacatatttaaccc 211440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 344 - 413
Target Start/End: Original strand, 8710363 - 8710432
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||| |||||||| |||||||  ||||||||| ||||||| || ||| | |||||||||||||||||    
8710363 atttaatgaaatgtaaggactattcttcaaaggggtgcaaaatataaggactaaaaacatatttaaccct 8710432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 412
Target Start/End: Original strand, 17157856 - 17157924
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccc 412  Q
    ||||||| |||||||  |||||||  |||||| ||||||||||||| ||| | ||||||||||||||||    
17157856 atttaatgaaatgtagggactattcttcaaagtggcgcaaaatgtaaggactaaaaacatatttaaccc 17157924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 411
Target Start/End: Original strand, 211744 - 211811
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    ||||||| |||||||  |||||||  |||||  ||||||||||||| ||||| |||||||||||||||    
211744 atttaatgaaatgtagggactattcttcaaataggcgcaaaatgtaaggattaaaaacatatttaacc 211811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 352 - 411
Target Start/End: Complemental strand, 14712889 - 14712830
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaacc 411  Q
    |||||||| |||||||| |||||| | |||||||||||||||   |||||||||||||||    
14712889 aaatgtaaggactatttttcaaagtgacgcaaaatgtagggaccaaaaacatatttaacc 14712830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 344 - 410
Target Start/End: Original strand, 14713029 - 14713095
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaac 410  Q
    ||||||| |||||||| |||||||  ||||| | |||||||||||| | ||| ||||||||||||||    
14713029 atttaatgaaatgtaaggactattcttcaaaagagcgcaaaatgtaagaattaaaaacatatttaac 14713095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 413
Target Start/End: Complemental strand, 5974078 - 5974009
Alignment:
344 atttaataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    ||||||| |||||||  |||||||  ||||||||| ||||||| || ||| | |||||||||||||||||    
5974078 atttaatgaaatgtagggactattcttcaaaggggtgcaaaatataaggactaaaaacatatttaaccct 5974009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0063
Description:

Target: scaffold0063; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 410
Target Start/End: Original strand, 35219 - 35281
Alignment:
348 aataaaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaac 410  Q
    ||||||||||| ||||||||  |||||||| ||||||||||| ||| | ||||||||||||||    
35219 aataaaatgtagagactattcttcaaagggacgcaaaatgtaaggactaaaaacatatttaac 35281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0177 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0177
Description:

Target: scaffold0177; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 352 - 413
Target Start/End: Original strand, 25873 - 25934
Alignment:
352 aaatgtaaagactatttatcaaaggggcgcaaaatgtagggattgaaaacatatttaaccct 413  Q
    |||||||  |||||||||||||| | ||| |||||||||||| | |||||||||||||||||    
25873 aaatgtagggactatttatcaaaagagcgtaaaatgtagggactaaaaacatatttaaccct 25934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199075 times since January 2019
Visitors: 2774