View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-3 (Length: 449)

Name: F9350-LTR4-TNT-insertion-3
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9350-LTR4-TNT-insertion-3
F9350-LTR4-TNT-insertion-3
[»] chr8 (2 HSPs)
chr8 (5-440)||(40512696-40513131)
chr8 (212-303)||(40526871-40526966)


Alignment Details
Target: chr8 (Bit Score: 432; Significance: 0; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 432; E-Value: 0
Query Start/End: Original strand, 5 - 440
Target Start/End: Original strand, 40512696 - 40513131
Alignment:
5 acactaacaacagtttacatatgaaattaaattaagataccacgacacgagagtaattttgtcttattattctgtcttaagcgcttggttattcttagac 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40512696 acactaacaacagtttacatatgaaattaaattaagataccacgacacgagagtaattttgtcttattattctgtcttaagcgcttggttattcttagac 40512795  T
105 atacgaagatcgccgttcttacaggaaggcttttgccaaaggccaaagatgtgtcgttctgcccagtccactaacccaggaaaaagcagcttagaaggaa 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
40512796 atacgaagatcgccgttcttacaggaaggcttttgccaaaggccaaagatgtgtcgttctgcccagtccactaactcaggaaaaagcagcttagaaggaa 40512895  T
205 acaccgctttgagccatgaagggtttgtcacatacatatctcccctgcacgcactttttactatgtctttggcacattcatttgctgatcccaatggaat 304  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40512896 acaccgctttgagccatgaagggtttgtcacatacatatctcccctgcacgcactttttactatgtctttggcacattcatttgctgatcccaatggaat 40512995  T
305 ccattgcagactagcctacaatagttagttaatgttgtgaataaatgaattagaataagaacacacacagtagtgtaaactgcattggttgaagtttaaa 404  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40512996 ccattgcagactagcctacaatagttagttaatgttgtgaataaatgaattagaataagaacacacacagtagtgtaaactgcattggttgaagtttaaa 40513095  T
405 ttaaaggaggtgtaatattatgcatggaaccaattg 440  Q
    ||||||||||||||||||||||||||||||||||||    
40513096 ttaaaggaggtgtaatattatgcatggaaccaattg 40513131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 212 - 303
Target Start/End: Original strand, 40526871 - 40526966
Alignment:
212 tttgagccatgaagggtt----tgtcacatacatatctcccctgcacgcactttttactatgtctttggcacattcatttgctgatcccaatggaa 303  Q
    ||||||||||||||||||    ||||||||| |||||||||||||| |||| ||| |||||||||||||||||||||  || ||| ||||||||||    
40526871 tttgagccatgaagggttggtttgtcacataaatatctcccctgcatgcacctttcactatgtctttggcacattcaactgatgaacccaatggaa 40526966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 38025 times since January 2019
Visitors: 1598