View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-3 (Length: 449)

Name: F9350-LTR4-TNT-insertion-3
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9350-LTR4-TNT-insertion-3
[»] chr8 (2 HSPs)
chr8 (5-440)||(40512696-40513131)
chr8 (212-303)||(40526871-40526966)

Alignment Details
Target: chr8 (Bit Score: 432; Significance: 0; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 432; E-Value: 0
Query Start/End: Original strand, 5 - 440
Target Start/End: Original strand, 40512696 - 40513131
5 acactaacaacagtttacatatgaaattaaattaagataccacgacacgagagtaattttgtcttattattctgtcttaagcgcttggttattcttagac 104  Q
40512696 acactaacaacagtttacatatgaaattaaattaagataccacgacacgagagtaattttgtcttattattctgtcttaagcgcttggttattcttagac 40512795  T
105 atacgaagatcgccgttcttacaggaaggcttttgccaaaggccaaagatgtgtcgttctgcccagtccactaacccaggaaaaagcagcttagaaggaa 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
40512796 atacgaagatcgccgttcttacaggaaggcttttgccaaaggccaaagatgtgtcgttctgcccagtccactaactcaggaaaaagcagcttagaaggaa 40512895  T
205 acaccgctttgagccatgaagggtttgtcacatacatatctcccctgcacgcactttttactatgtctttggcacattcatttgctgatcccaatggaat 304  Q
40512896 acaccgctttgagccatgaagggtttgtcacatacatatctcccctgcacgcactttttactatgtctttggcacattcatttgctgatcccaatggaat 40512995  T
305 ccattgcagactagcctacaatagttagttaatgttgtgaataaatgaattagaataagaacacacacagtagtgtaaactgcattggttgaagtttaaa 404  Q
40512996 ccattgcagactagcctacaatagttagttaatgttgtgaataaatgaattagaataagaacacacacagtagtgtaaactgcattggttgaagtttaaa 40513095  T
405 ttaaaggaggtgtaatattatgcatggaaccaattg 440  Q
40513096 ttaaaggaggtgtaatattatgcatggaaccaattg 40513131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 212 - 303
Target Start/End: Original strand, 40526871 - 40526966
212 tttgagccatgaagggtt----tgtcacatacatatctcccctgcacgcactttttactatgtctttggcacattcatttgctgatcccaatggaa 303  Q
    ||||||||||||||||||    ||||||||| |||||||||||||| |||| ||| |||||||||||||||||||||  || ||| ||||||||||    
40526871 tttgagccatgaagggttggtttgtcacataaatatctcccctgcatgcacctttcactatgtctttggcacattcaactgatgaacccaatggaa 40526966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175465 times since January 2019
Visitors: 2677