View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-5 (Length: 759)

Name: F9350-LTR4-TNT-insertion-5
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9350-LTR4-TNT-insertion-5
F9350-LTR4-TNT-insertion-5
[»] chr4 (4 HSPs)
chr4 (10-751)||(43627569-43628310)
chr4 (527-636)||(22683832-22683941)
chr4 (558-636)||(53782600-53782678)
chr4 (558-635)||(4014167-4014244)
[»] chr2 (7 HSPs)
chr2 (561-663)||(32307087-32307188)
chr2 (556-625)||(44810372-44810441)
chr2 (558-635)||(44439253-44439330)
chr2 (541-634)||(37561689-37561782)
chr2 (553-608)||(3654930-3654985)
chr2 (585-635)||(32798517-32798567)
chr2 (558-624)||(37402253-37402319)
[»] chr5 (3 HSPs)
chr5 (541-632)||(3970412-3970503)
chr5 (558-635)||(29923241-29923318)
chr5 (536-594)||(9818712-9818769)
[»] chr8 (2 HSPs)
chr8 (569-679)||(2764434-2764544)
chr8 (561-634)||(4275750-4275823)
[»] chr7 (3 HSPs)
chr7 (542-635)||(18349758-18349851)
chr7 (560-634)||(19098495-19098569)
chr7 (558-635)||(42675059-42675136)
[»] chr1 (4 HSPs)
chr1 (558-642)||(35592496-35592579)
chr1 (569-635)||(17753512-17753577)
chr1 (572-665)||(27500298-27500391)
chr1 (559-635)||(50845157-50845234)
[»] chr6 (2 HSPs)
chr6 (558-635)||(25195580-25195657)
chr6 (560-635)||(10564933-10565008)
[»] scaffold1528 (1 HSPs)
scaffold1528 (572-635)||(239-301)
[»] scaffold0248 (1 HSPs)
scaffold0248 (572-635)||(13353-13415)
[»] chr3 (3 HSPs)
chr3 (554-608)||(23290288-23290342)
chr3 (604-670)||(35264385-35264451)
chr3 (573-626)||(21513364-21513417)


Alignment Details
Target: chr4 (Bit Score: 715; Significance: 0; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 715; E-Value: 0
Query Start/End: Original strand, 10 - 751
Target Start/End: Original strand, 43627569 - 43628310
Alignment:
10 aatgacatataatacgataggcgtgttggaactctcaattcttcacttttcagtatttaatgtgtgtgaattttactgctaaactctttagatttaaaaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43627569 aatgacatataatacgataggcgtgttggaactctcaattcttcacttttcagtatttaatgtgtgtgaattttactgctaaactctttagatttaaaaa 43627668  T
110 agaaagnnnnnnnnnccttgaaattgaatatgtaccactcattcatgtagaatgacactctaaagtttagagggagcaaacaccttcaatggcaacttgt 209  Q
    ||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43627669 agaaagtttttttttccttgaaattgaatatgtaccactcattcatgtagaatgacactctaaagtttagagggagcaaacaccttcaatggcaacttgt 43627768  T
210 tggatttatccttgattcaaacataatatgtatgtttgattacatttttggacaagtataattgattttgacatatattgaaaaaatcaagtaccacatg 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43627769 tggatttatccttgattcaaacataatatgtatgtttgattacatttttggacaagtataattgattttgacatatattgaaaaaatcaagtaccacatg 43627868  T
310 tattaaagttaaggtccaactaaagtatataaaaagcgtcaccgctcgtataaatacataatatgatattagagcatgtgatttttatatcactcatcat 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43627869 tattaaagttaaggtccaactaaagtatataaaaagcgtcaccgctcgtataaatacataatatgatattagagcatgtgatttttatatcactcatcat 43627968  T
410 ttatatcctttcataaagtccaatagttttatgggtgattgattacactaaggtcccatatatattaaagataaagtcttattagagtgtataaagagac 509  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43627969 ttatatcctttcataaagtccaatagttttatgggtgattgattacactaaggtcccatatatattaaagataaagtcttattagagtgtataaagagac 43628068  T
510 acaccattcgctttaaattttcgagtaaaaatgattttgcttccatagttgattctaagttgaagctaagatttgtagattttgactccaaacatgattt 609  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43628069 acaccattcgctttaaattttcgagtaaaaatgattttgcttccatagttgattctaagttgaagctaagatttgtagattttgactccaaacatgattt 43628168  T
610 taacatttaaatttattgttcaactcgtatttatatgaatgcatccaaatataaatcacttgatattcaattagcttataaggctaagctgcatatttgg 709  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43628169 taacatttaaatttattgttcaactcgtatttatatgaatgcatccaaatataaatcacttgatattcaattagcttataaggctaagctgcatatttgg 43628268  T
710 tcccttaattaaattaagagtttcattttggtcctctaatta 751  Q
    ||||||||||||||||||||||||||||||||||||||||||    
43628269 tcccttaattaaattaagagtttcattttggtcctctaatta 43628310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 527 - 636
Target Start/End: Original strand, 22683832 - 22683941
Alignment:
527 ttttcgagtaaaaatgattttgcttccatagttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttatt 626  Q
    |||| |||||||| ||||||||| |||| | || ||| ||| ||||||||| ||| ||||| |||||| || |||| ||||||| ||||| |||||||||    
22683832 tttttgagtaaaattgattttgcctccagaattaattataacttgaagctatgatctgtagcttttgagtctaaacgtgatttttacattgaaatttatt 22683931  T
627 gttcaactcg 636  Q
    ||||||||||    
22683932 gttcaactcg 22683941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 558 - 636
Target Start/End: Original strand, 53782600 - 53782678
Alignment:
558 ttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactcg 636  Q
    |||||||||| ||||||| | |||||||||||||||| | ||||||| ||||| ||| | |||| |||  |||||||||    
53782600 ttgattctaatttgaagccaggatttgtagattttgatttcaaacataatttttacactcaaatatatctttcaactcg 53782678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 558 - 635
Target Start/End: Original strand, 4014167 - 4014244
Alignment:
558 ttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||||| ||||||||| |||||  |  |||||||||||||| | ||||| ||| | |||||||| |||||||||    
4014167 ttgattctaacttgaagctatgatttaaatcttttgactccaaacgtaatttttacagtaaaatttatggttcaactc 4014244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 2e-17; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 561 - 663
Target Start/End: Original strand, 32307087 - 32307188
Alignment:
561 attctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactcgtatttatatgaatgcatccaaata 660  Q
    ||||||| |||||||||||||||||||  |||| |||||||||||||||| ||| ||| ||||||||||||||||   ||||| |||||  |||||||||    
32307087 attctaatttgaagctaagatttgtagtgtttg-ctccaaacatgatttttacacttatatttattgttcaactcacttttatgtgaatttatccaaata 32307185  T
661 taa 663  Q
    |||    
32307186 taa 32307188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 556 - 625
Target Start/End: Original strand, 44810372 - 44810441
Alignment:
556 agttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttat 625  Q
    |||||||||||| ||||||||| ||||||||| |||||||  ||||||||||||||||||| ||||||||    
44810372 agttgattctaacttgaagctaggatttgtagcttttgacggcaaacatgattttaacattcaaatttat 44810441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 558 - 635
Target Start/End: Original strand, 44439253 - 44439330
Alignment:
558 ttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||||| |||||||||| ||||| || |||||| || |||  ||||||||||| | ||||||||||||||||||    
44439253 ttgattctaacttgaagctaaaatttggagcttttgattctaaaattgattttaacactcaaatttattgttcaactc 44439330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 541 - 634
Target Start/End: Original strand, 37561689 - 37561782
Alignment:
541 tgattttgcttccatagttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaact 634  Q
    ||||||||| || ||| |||||||||| ||||| ||| ||||||||  |||||||| ||||  ||||||| ||| | |||| ||||||||||||    
37561689 tgattttgcctctataattgattctaacttgaaactacgatttgtaccttttgacttcaaatgtgatttttacactcaaatctattgttcaact 37561782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 553 - 608
Target Start/End: Complemental strand, 3654985 - 3654930
Alignment:
553 catagttgattctaagttgaagctaagatttgtagattttgactccaaacatgatt 608  Q
    |||| |||||||||| || |||||| ||||||||  ||||||||||||||||||||    
3654985 catacttgattctaacttcaagctaggatttgtaccttttgactccaaacatgatt 3654930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 585 - 635
Target Start/End: Complemental strand, 32798567 - 32798517
Alignment:
585 tagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    ||||| || ||||||||||||||||| ||| ||| ||||||||||||||||    
32798567 tagatgtttactccaaacatgatttttacacttatatttattgttcaactc 32798517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 558 - 624
Target Start/End: Complemental strand, 37402319 - 37402253
Alignment:
558 ttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaattta 624  Q
    |||| ||||| |||||||||  |||||||| |||||||| ||||||||||| | ||| |||||||||    
37402319 ttgactctaacttgaagctagaatttgtagcttttgacttcaaacatgattgttacacttaaattta 37402253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 541 - 632
Target Start/End: Complemental strand, 3970503 - 3970412
Alignment:
541 tgattttgcttccatagttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaa 632  Q
    ||||||||| |||| | ||||||||||  |||||||| || |||||| |||||||||||||| ||||||| ||||||||| ||| |||||||    
3970503 tgattttgcctccagaattgattctaatctgaagctaggaattgtagcttttgactccaaacttgatttttacatttaaaattactgttcaa 3970412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 558 - 635
Target Start/End: Original strand, 29923241 - 29923318
Alignment:
558 ttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||||| ||||||||||||||||| | |||| |||| |||| ||||||| ||| | ||||||| |||| |||||    
29923241 ttgattctaacttgaagctaagatttgtcgtttttaactcaaaacgtgatttttacactcaaatttaatgtttaactc 29923318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 536 - 594
Target Start/End: Original strand, 9818712 - 9818769
Alignment:
536 aaaaatgattttgcttccatagttgattctaagttgaagctaagatttgtagattttga 594  Q
    |||||||||||||| |||||| |||||||| | ||||||||| ||||||||| ||||||    
9818712 aaaaatgattttgcctccataattgattct-acttgaagctatgatttgtagcttttga 9818769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 569 - 679
Target Start/End: Complemental strand, 2764544 - 2764434
Alignment:
569 ttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactcgtatttatatgaatgcatccaaatataaatcac 668  Q
    |||||| |||||||||||| ||||| |||||||  ||||||| || ||  ||||||| |||||||||   ||||  |||||| |||||||||||||||||    
2764544 ttgaagttaagatttgtagcttttggctccaaatgtgatttttactttcgaatttatggttcaactcacttttacgtgaatgtatccaaatataaatcac 2764445  T
669 ttgatattcaa 679  Q
    || ||||||||    
2764444 tttatattcaa 2764434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 561 - 634
Target Start/End: Complemental strand, 4275823 - 4275750
Alignment:
561 attctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaact 634  Q
    ||||||| |||||| ||||||||||| ||||| | || |||||||||||    |||||||||||||||||||||    
4275823 attctaatttgaagataagatttgtatatttttagtctaaacatgatttatgtatttaaatttattgttcaact 4275750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000005; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 542 - 635
Target Start/End: Original strand, 18349758 - 18349851
Alignment:
542 gattttgcttccatagttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||  |||||| |||||| ||| |||||| || | ||||||| |||||||| ||||| ||||||| ||| | ||||||||||||||||||    
18349758 gattttgactccataattgattttaatttgaagttagggtttgtagcttttgacttcaaacgtgatttttacactcaaatttattgttcaactc 18349851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 560 - 634
Target Start/End: Complemental strand, 19098569 - 19098495
Alignment:
560 gattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaact 634  Q
    |||||||  ||||||||||||||||||| ||||| |||||||||| ||||| ||| | ||||||||  |||||||    
19098569 gattctatcttgaagctaagatttgtagtttttgcctccaaacataatttttacactcaaatttatcattcaact 19098495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 558 - 635
Target Start/End: Complemental strand, 42675136 - 42675059
Alignment:
558 ttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||||| ||| | ||| |||| ||||||||||| ||||||||| ||||| |||||  ||||||| |||||||||    
42675136 ttgattctaacttggaactaggattggtagattttgattccaaacataatttttacattagaatttatcgttcaactc 42675059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000002; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 558 - 642
Target Start/End: Original strand, 35592496 - 35592579
Alignment:
558 ttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactcgtattta 642  Q
    |||||||||| || |||||| ||||| ||| ||||||||| |||||| ||||| ||| ||||||||||| |||||||||| ||||    
35592496 ttgattctaacttaaagctaggatttttagcttttgactctaaacat-atttttacacttaaatttattcttcaactcgttttta 35592579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 569 - 635
Target Start/End: Original strand, 17753512 - 17753577
Alignment:
569 ttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||||||||||||||  |||| ||||| |||||||||| ||| ||| ||||||||||||||||    
17753512 ttgaagctaagatttgtagtgtttg-ctccagacatgatttttacagttatatttattgttcaactc 17753577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 572 - 665
Target Start/End: Original strand, 27500298 - 27500391
Alignment:
572 aagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactcgtatttatatgaatgcatccaaatataaat 665  Q
    |||||||||||| ||| ||||  |||||||||| ||||| ||| | |||||||||||||||||| | |||| |||||  |||||| | ||||||    
27500298 aagctaagatttttagcttttccctccaaacattatttttacactcaaatttattgttcaactcatttttacatgaacacatccagacataaat 27500391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 559 - 635
Target Start/End: Original strand, 50845157 - 50845234
Alignment:
559 tgattctaagttgaagctaagattt-gtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||||||||||| | |||||| |||| ||||| |||||||  | ||||| | | ||||||||||||||||||||    
50845157 tgattctaagttgaagatcagattttgtagtttttgcctccaaatgtaatttttatacttaaatttattgttcaactc 50845234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.000000001; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 558 - 635
Target Start/End: Original strand, 25195580 - 25195657
Alignment:
558 ttgattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||||| ||||| ||| ||| ||||| |||||||||||||| ||||||| | | | ||||| ||||||||||||    
25195580 ttgattctaacttgaaactaggatctgtagcttttgactccaaacgtgattttcatactaaaattcattgttcaactc 25195657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 560 - 635
Target Start/End: Complemental strand, 10565008 - 10564933
Alignment:
560 gattctaagttgaagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    |||||||| |||||| || ||||||||| ||||||||| |||  ||||||||||  | || |||||||||||||||    
10565008 gattctaacttgaagttaggatttgtagcttttgactcaaaatgtgattttaacgctaaagtttattgttcaactc 10564933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1528 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold1528
Description:

Target: scaffold1528; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 572 - 635
Target Start/End: Original strand, 239 - 301
Alignment:
572 aagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    ||||||||||||||||  |||| ||||| |||||||||| ||| ||| ||||||||||||||||    
239 aagctaagatttgtagtgtttg-ctccagacatgatttttacagttatatttattgttcaactc 301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0248 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0248
Description:

Target: scaffold0248; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 572 - 635
Target Start/End: Complemental strand, 13415 - 13353
Alignment:
572 aagctaagatttgtagattttgactccaaacatgattttaacatttaaatttattgttcaactc 635  Q
    ||||||||||||||||  |||| ||||| |||||||||| ||| ||| ||||||||||||||||    
13415 aagctaagatttgtagtgtttg-ctccagacatgatttttacagttatatttattgttcaactc 13353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000007; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 554 - 608
Target Start/End: Original strand, 23290288 - 23290342
Alignment:
554 atagttgattctaagttgaagctaagatttgtagattttgactccaaacatgatt 608  Q
    |||||||||||||| ||||| ||| ||||||||| ||||| | ||||||||||||    
23290288 atagttgattctaacttgaaactatgatttgtagcttttgcccccaaacatgatt 23290342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 604 - 670
Target Start/End: Complemental strand, 35264451 - 35264385
Alignment:
604 tgattttaacatttaaatttattgttcaactcgtatttatatgaatgcatccaaatataaatcactt 670  Q
    ||||||||||| ||||||||||||||||| || | |||| ||||||| | ||||| |||| ||||||    
35264451 tgattttaacacttaaatttattgttcaagtcatttttacatgaatgtacccaaacataactcactt 35264385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 573 - 626
Target Start/End: Complemental strand, 21513417 - 21513364
Alignment:
573 agctaagatttgtagattttgactccaaacatgattttaacatttaaatttatt 626  Q
    ||||| ||||||||| |||||||||||||| ||||||| ||| | |||||||||    
21513417 agctaggatttgtagcttttgactccaaacgtgatttttacactcaaatttatt 21513364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37852 times since January 2019
Visitors: 1597