View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-6 (Length: 695)

Name: F9350-LTR4-TNT-insertion-6
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9350-LTR4-TNT-insertion-6
[»] chr4 (8 HSPs)
chr4 (8-634)||(21548315-21548941)
chr4 (478-591)||(18912287-18912406)
chr4 (332-390)||(5370328-5370385)
chr4 (331-390)||(30000047-30000105)
chr4 (333-390)||(12739792-12739848)
chr4 (333-390)||(12747998-12748054)
chr4 (515-591)||(8114705-8114780)
chr4 (330-390)||(9927699-9927758)
[»] chr7 (6 HSPs)
chr7 (328-425)||(23575170-23575267)
chr7 (478-511)||(31151066-31151099)
chr7 (478-510)||(31169355-31169387)
chr7 (331-390)||(47676378-47676436)
chr7 (375-465)||(4162575-4162665)
chr7 (333-390)||(29990925-29990981)
[»] chr8 (4 HSPs)
chr8 (479-586)||(11772000-11772112)
chr8 (116-158)||(40745174-40745216)
chr8 (331-390)||(3051395-3051453)
chr8 (331-390)||(44303722-44303780)
[»] chr6 (2 HSPs)
chr6 (479-600)||(1115029-1115156)
chr6 (517-591)||(30518097-30518171)
[»] chr3 (2 HSPs)
chr3 (130-214)||(25173907-25173990)
chr3 (117-227)||(34695122-34695231)
[»] scaffold0016 (2 HSPs)
scaffold0016 (515-591)||(102461-102537)
scaffold0016 (331-390)||(114458-114516)
[»] chr5 (4 HSPs)
chr5 (327-419)||(41011605-41011696)
chr5 (331-390)||(32636692-32636750)
chr5 (330-380)||(9049607-9049656)
chr5 (331-380)||(42428682-42428730)
[»] chr2 (4 HSPs)
chr2 (402-466)||(39533087-39533151)
chr2 (545-586)||(5077790-5077831)
chr2 (331-391)||(12632958-12633017)
chr2 (554-586)||(39532951-39532983)
[»] scaffold0076 (1 HSPs)
scaffold0076 (545-590)||(15985-16030)
[»] scaffold0128 (1 HSPs)
scaffold0128 (403-463)||(19402-19462)
[»] chr1 (1 HSPs)
chr1 (515-591)||(48382448-48382524)

Alignment Details
Target: chr4 (Bit Score: 597; Significance: 0; HSPs: 8)
Name: chr4

Target: chr4; HSP #1
Raw Score: 597; E-Value: 0
Query Start/End: Original strand, 8 - 634
Target Start/End: Original strand, 21548315 - 21548941
8 aaaatagatgtttgtatgtagtgaatgttattgaggaatcaaaagatcatgacccaatatgtattgaagacgtttaaggttcgtcaaaaatcatgtcata 107  Q
21548315 aaaatagatgtttgtatgtagtgaatgttattgaggaatcaaaagatcatgacccaatatgtattgaagacgtttaaggttcgtcaaaaatcatgtcata 21548414  T
108 ataggtataaatcgtgatgcgatttggtttagcaatttggaggttttggtttgcaaaatttcatggcacgaatgggagaactcatggtgcgatttgtgga 207  Q
21548415 ataggtataaatcgtgatgcgatttggtttagcaatttggaggttttggtttgcaaaatttcatggcacgaatgggagaactcatggtgcgatttgtgga 21548514  T
208 tcaagttcaatattgcactgttacgagctccaaatcgtggcgcgaactaggaaaattaaatggtgcgattttgcctaggcatgagtactatataagcctt 307  Q
21548515 tcaagttcaatattgcactgttacgagctccaaatcgtggcgcgaactaggaaaattaaatggtgcgattttgcctaggcatgagtactatataagcctt 21548614  T
308 caatcttcannnnnnnnnnagtggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtctttaggtaaggttcatgggt 407  Q
    |||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21548615 caatcttcattttttttttagtggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtctttaggtaaggttcatgggt 21548714  T
408 taggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaaaatttctcctaagagattcattgtgagtttgagtgacttggaaa 507  Q
21548715 taggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaaaatttctcctaagagattcattgtgagtttgagtgacttggaaa 21548814  T
508 atgggtaagggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagagatctactctcccccgga 607  Q
21548815 atgggtaagggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagagatctactctcccccgga 21548914  T
608 tgtaagataaattggtccaaactggat 634  Q
21548915 tgtaagataaattggtccaaactggat 21548941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 478 - 591
Target Start/End: Original strand, 18912287 - 18912406
478 gattcattgtgagtttgagtgacttggaaaatgggta------agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactc 571  Q
    ||||||||||| |||||||||||||| ||||||| ||      ||||||||||||||||||  ||  ||| | |||||||| | ||| | ||||||||||    
18912287 gattcattgtgggtttgagtgacttgaaaaatggatataatttagggtttgttctttgtgagtttgtaaactaatttcttgtatcctttttgtatcactc 18912386  T
572 ttatcatagtggattagaga 591  Q
    ||||||||||||||| ||||    
18912387 ttatcatagtggattggaga 18912406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 332 - 390
Target Start/End: Complemental strand, 5370385 - 5370328
332 cttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    ||||||||||||||| ||||||||||| |||||||| |||||||||||| || ||||||    
5370385 cttgaagagagagaaacttgagaaatc-aaaggagacaactttagggtttagggtcttt 5370328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Complemental strand, 30000105 - 30000047
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| |||| |||||| |||||||| |||||||||||| || ||||||    
30000105 gcttgaagagagagaaacttgggaaatc-aaaggagacaactttagggtttagggtcttt 30000047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 390
Target Start/End: Complemental strand, 12739848 - 12739792
333 ttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||| ||||||||||| |||||||  |||||||||||| || ||||||    
12739848 ttgaagagagagaaacttgagaaatc-aaaggaggtaactttagggttgagggtcttt 12739792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 390
Target Start/End: Complemental strand, 12748054 - 12747998
333 ttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||| ||||||||||| |||||||  |||||||||||| || ||||||    
12748054 ttgaagagagagaaacttgagaaatc-aaaggaggtaactttagggttgagggtcttt 12747998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 515 - 591
Target Start/End: Original strand, 8114705 - 8114780
515 agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagaga 591  Q
    ||||||||||||||||||  ||| || | ||||||||| ||||| | | ||||| ||||||||||||||||| ||||    
8114705 agggtttgttctttgtgagattataagt-gatttcttgtaacctatttatatcattcttatcatagtggattggaga 8114780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 330 - 390
Target Start/End: Complemental strand, 9927758 - 9927699
330 ggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    ||||||||||||||||| |||| |||||| |||||||  |||||||||||| || ||||||    
9927758 ggcttgaagagagagaaacttgggaaatc-aaaggaggtaactttagggttgagggtcttt 9927699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 6)
Name: chr7

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 328 - 425
Target Start/End: Original strand, 23575170 - 23575267
328 gtggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtctttaggtaaggttcatgggttaggaaacacttcacaaa 425  Q
    |||||||||||||||||||||||  ||||   ||||||||||| ||||||||| |||||||||  || || |||||||||| | |||||||| |||||    
23575170 gtggcttgaagagagagaatctttggaaaagaaaaggagagaagtttagggttgagtgtctttgagtgagattcatgggttggaaaacacttgacaaa 23575267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 478 - 511
Target Start/End: Original strand, 31151066 - 31151099
478 gattcattgtgagtttgagtgacttggaaaatgg 511  Q
31151066 gattcattgtgagtttgagtgacttggaaaatgg 31151099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 478 - 510
Target Start/End: Original strand, 31169355 - 31169387
478 gattcattgtgagtttgagtgacttggaaaatg 510  Q
31169355 gattcattgtgagtttgagtgacttggaaaatg 31169387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Complemental strand, 47676436 - 47676378
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| |||| |||||| |||||||| |||||||||||| || ||||||    
47676436 gcttgaagagagagaaacttgggaaatc-aaaggagataactttagggttgagggtcttt 47676378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 375 - 465
Target Start/End: Original strand, 4162575 - 4162665
375 agggttaagtgtctttaggtaaggttcatgggttaggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaaaa 465  Q
    |||||||||||||||||||| || ||  ||||||   ||| |||||||||| || ||||||  ||| |||||||| |||||||||| ||||    
4162575 agggttaagtgtctttaggtgagatttttgggttgataaatacttcacaaatatcttgggtagtgatatctcatttgagaaaggatgaaaa 4162665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 390
Target Start/End: Original strand, 29990925 - 29990981
333 ttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||| |||| |||||| |||||||| |||||||||||| || ||||||    
29990925 ttgaagagagagaaacttgggaaatc-aaaggagacaactttagggtttagggtcttt 29990981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 4)
Name: chr8

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 479 - 586
Target Start/End: Complemental strand, 11772112 - 11772000
479 attcattgtgagtttgagtgacttggaaaatgggtaa-----gggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactctt 573  Q
    |||||||| | |||||||||||||| |||| ||||||     || | ||||||||||||||||  ||| | |||||||  ||||||| ||||||||||||    
11772112 attcattgggggtttgagtgacttgaaaaaagggtaatattaggatatgttctttgtgaacttgtaaactaatttcttttaacctctttgtatcactctt 11772013  T
574 atcatagtggatt 586  Q
11772012 atcatagtggatt 11772000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 158
Target Start/End: Original strand, 40745174 - 40745216
116 aaatcgtgatgcgatttggtttagcaatttggaggttttggtt 158  Q
    ||||| || ||||||||||||||||||||||||||||||||||    
40745174 aaatcatggtgcgatttggtttagcaatttggaggttttggtt 40745216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Complemental strand, 3051453 - 3051395
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| |||| ||  | |||||||||||||||||||||| |||||||||    
3051453 gcttgaagagagagaaacttgggac-tataaaggagagaactttagggttgagtgtcttt 3051395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Original strand, 44303722 - 44303780
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| ||||||||||| |||||| | |||||||||||| || ||||||    
44303722 gcttgaagagagagaaacttgagaaatc-aaaggaaacaactttagggtttagggtcttt 44303780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 2)
Name: chr6

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 479 - 600
Target Start/End: Original strand, 1115029 - 1115156
479 attcattgtgagtttgagtgacttggaaaatgggta------agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactct 572  Q
    ||||||||||||| || |||||||| ||||||| ||      |||||||||| ||| ||| |||  || ||||||||||| ||||| | ||||||| |||    
1115029 attcattgtgagtgtgggtgacttgaaaaatggatagaaattagggtttgttatttttgagcttttaagttgatttcttgtaacctatttgtatcattct 1115128  T
573 tatcatagtggattagagatctactctc 600  Q
    |||||||||||||| ||||||| |||||    
1115129 tatcatagtggattggagatctgctctc 1115156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 517 - 591
Target Start/End: Original strand, 30518097 - 30518171
517 ggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagaga 591  Q
    ||||||||||||||||||||  || ||  |||| || ||||||| |||||||||||||||||||||||| |||||    
30518097 ggtttgttctttgtgaacttttaagttagtttcatgtaacctctttgtatcactcttatcatagtggatcagaga 30518171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 25173990 - 25173907
130 tttggtttagcaatttggaggttttggtttgcaaaatttcatggcacgaatgggagaactcatggtgcgatttgtggatcaagtt 214  Q
    ||||||| | |||||||||| ||||||||||||||||||| ||| |||| | |||||| ||||||| |||||| |||||||||||    
25173990 tttggttcaacaatttggagtttttggtttgcaaaatttcgtggaacgatttggagaaatcatggtacgattt-tggatcaagtt 25173907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 227
Target Start/End: Original strand, 34695122 - 34695231
117 aatcgtgatgcgatttggtttagcaatttggaggttttggtttgcaaaatttcatggcacgaatgggagaactcatggtgcgatttgtggatcaagttca 216  Q
    |||||||| ||||||||||| |||||||| ||||||||||||    ||| |||||||| | | |||||||| |||||||  ||||| ||| | |||||||    
34695122 aatcgtgacgcgatttggttgagcaatttagaggttttggttctagaaagttcatggcgcaattgggagaaatcatggtatgattt-tgggtgaagttca 34695220  T
217 atattgcactg 227  Q
    |||||| ||||    
34695221 atattgtactg 34695231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: scaffold0016

Target: scaffold0016; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 515 - 591
Target Start/End: Original strand, 102461 - 102537
515 agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagaga 591  Q
    |||||||||| ||||||| |||  ||  | |||||||| ||||||| ||||||||||||||||| |||||| |||||    
102461 agggtttgttttttgtgagcttttaagataatttcttgtaacctctttgtatcactcttatcattgtggatcagaga 102537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Original strand, 114458 - 114516
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| ||||||||||| |||||||  |||||||||||| || ||||||    
114458 gcttgaagagagagaaacttgagaaatc-aaaggaggtaactttagggttgagggtcttt 114516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000004; HSPs: 4)
Name: chr5

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 327 - 419
Target Start/End: Original strand, 41011605 - 41011696
327 agtggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtctttaggtaaggttcatgggttaggaaacactt 419  Q
    |||| ||| |||||||||||| |||| ||||| ||| ||| ||||||||   || ||||||||| |||||||||| | |||||||||||||||    
41011605 agtgccttcaagagagagaatattga-aaatccaaaagagggaactttaaaatttagtgtctttgggtaaggttcttaggttaggaaacactt 41011696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Original strand, 32636692 - 32636750
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    ||||| |||||||||| ||||||||||| |||||||  ||||||||||||||| ||||||    
32636692 gcttggagagagagaaacttgagaaatc-aaaggaggtaactttagggttaagggtcttt 32636750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 330 - 380
Target Start/End: Complemental strand, 9049656 - 9049607
330 ggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggtt 380  Q
    ||||| ||||||||||| ||||||||||| |||||||| ||||||||||||    
9049656 ggcttcaagagagagaaacttgagaaatc-aaaggagataactttagggtt 9049607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 331 - 380
Target Start/End: Complemental strand, 42428730 - 42428682
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggtt 380  Q
    |||||||||||||||| |||| |||||| |||||||| ||||||||||||    
42428730 gcttgaagagagagaaacttgggaaatc-aaaggagataactttagggtt 42428682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000004; HSPs: 4)
Name: chr2

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 402 - 466
Target Start/End: Complemental strand, 39533151 - 39533087
402 atgggttaggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaaaat 466  Q
    ||||||| |||||||||||||||| | |||||||  ||| ||||||||| ||||| |||||||||    
39533151 atgggttgggaaacacttcacaaacacattgggtagtgagatctcattacagaaatgatcaaaat 39533087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 545 - 586
Target Start/End: Complemental strand, 5077831 - 5077790
545 atttcttgcaacctctgtgtatcactcttatcatagtggatt 586  Q
    |||||||| |||| || |||||||||||||||||||||||||    
5077831 atttcttgtaaccactttgtatcactcttatcatagtggatt 5077790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 331 - 391
Target Start/End: Complemental strand, 12633017 - 12632958
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttta 391  Q
    |||| ||||||||||| |||| |||| | |||||||| |||||||||||| ||||||||||    
12633017 gcttcaagagagagaaacttgggaaacc-aaaggagataactttagggttgagtgtcttta 12632958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 554 - 586
Target Start/End: Complemental strand, 39532983 - 39532951
554 aacctctgtgtatcactcttatcatagtggatt 586  Q
    ||||||| |||||||||||||||||||||||||    
39532983 aacctctatgtatcactcttatcatagtggatt 39532951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0076

Target: scaffold0076; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 545 - 590
Target Start/End: Original strand, 15985 - 16030
545 atttcttgcaacctctgtgtatcactcttatcatagtggattagag 590  Q
    |||||||| ||| ||| ||||| |||||||||||||||||||||||    
15985 atttcttgtaacatctttgtataactcttatcatagtggattagag 16030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0128 (Bit Score: 29; Significance: 0.000001; HSPs: 1)
Name: scaffold0128

Target: scaffold0128; HSP #1
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 403 - 463
Target Start/End: Original strand, 19402 - 19462
403 tgggttaggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaa 463  Q
    |||||| |||||||||||| ||| || ||||||| ||| ||||| ||| ||||||||||||    
19402 tgggttgggaaacacttcagaaacattttgggttgtgagatctccttatagaaaggatcaa 19462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.000001; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 515 - 591
Target Start/End: Original strand, 48382448 - 48382524
515 agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagaga 591  Q
    |||||||| |||||||||||||  || || |||||||| ||||| | ||||||||| | |||||| |||||| ||||    
48382448 agggtttgatctttgtgaacttgtaagttaatttcttgtaacctatttgtatcactttcatcatattggattggaga 48382524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 37805 times since January 2019
Visitors: 1597