View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-6 (Length: 695)

Name: F9350-LTR4-TNT-insertion-6
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9350-LTR4-TNT-insertion-6
F9350-LTR4-TNT-insertion-6
[»] chr4 (8 HSPs)
chr4 (8-634)||(21548315-21548941)
chr4 (478-591)||(18912287-18912406)
chr4 (332-390)||(5370328-5370385)
chr4 (331-390)||(30000047-30000105)
chr4 (333-390)||(12739792-12739848)
chr4 (333-390)||(12747998-12748054)
chr4 (515-591)||(8114705-8114780)
chr4 (330-390)||(9927699-9927758)
[»] chr7 (6 HSPs)
chr7 (328-425)||(23575170-23575267)
chr7 (478-511)||(31151066-31151099)
chr7 (478-510)||(31169355-31169387)
chr7 (331-390)||(47676378-47676436)
chr7 (375-465)||(4162575-4162665)
chr7 (333-390)||(29990925-29990981)
[»] chr8 (4 HSPs)
chr8 (479-586)||(11772000-11772112)
chr8 (116-158)||(40745174-40745216)
chr8 (331-390)||(3051395-3051453)
chr8 (331-390)||(44303722-44303780)
[»] chr6 (2 HSPs)
chr6 (479-600)||(1115029-1115156)
chr6 (517-591)||(30518097-30518171)
[»] chr3 (2 HSPs)
chr3 (130-214)||(25173907-25173990)
chr3 (117-227)||(34695122-34695231)
[»] scaffold0016 (2 HSPs)
scaffold0016 (515-591)||(102461-102537)
scaffold0016 (331-390)||(114458-114516)
[»] chr5 (4 HSPs)
chr5 (327-419)||(41011605-41011696)
chr5 (331-390)||(32636692-32636750)
chr5 (330-380)||(9049607-9049656)
chr5 (331-380)||(42428682-42428730)
[»] chr2 (4 HSPs)
chr2 (402-466)||(39533087-39533151)
chr2 (545-586)||(5077790-5077831)
chr2 (331-391)||(12632958-12633017)
chr2 (554-586)||(39532951-39532983)
[»] scaffold0076 (1 HSPs)
scaffold0076 (545-590)||(15985-16030)
[»] scaffold0128 (1 HSPs)
scaffold0128 (403-463)||(19402-19462)
[»] chr1 (1 HSPs)
chr1 (515-591)||(48382448-48382524)


Alignment Details
Target: chr4 (Bit Score: 597; Significance: 0; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 597; E-Value: 0
Query Start/End: Original strand, 8 - 634
Target Start/End: Original strand, 21548315 - 21548941
Alignment:
8 aaaatagatgtttgtatgtagtgaatgttattgaggaatcaaaagatcatgacccaatatgtattgaagacgtttaaggttcgtcaaaaatcatgtcata 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21548315 aaaatagatgtttgtatgtagtgaatgttattgaggaatcaaaagatcatgacccaatatgtattgaagacgtttaaggttcgtcaaaaatcatgtcata 21548414  T
108 ataggtataaatcgtgatgcgatttggtttagcaatttggaggttttggtttgcaaaatttcatggcacgaatgggagaactcatggtgcgatttgtgga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21548415 ataggtataaatcgtgatgcgatttggtttagcaatttggaggttttggtttgcaaaatttcatggcacgaatgggagaactcatggtgcgatttgtgga 21548514  T
208 tcaagttcaatattgcactgttacgagctccaaatcgtggcgcgaactaggaaaattaaatggtgcgattttgcctaggcatgagtactatataagcctt 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21548515 tcaagttcaatattgcactgttacgagctccaaatcgtggcgcgaactaggaaaattaaatggtgcgattttgcctaggcatgagtactatataagcctt 21548614  T
308 caatcttcannnnnnnnnnagtggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtctttaggtaaggttcatgggt 407  Q
    |||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21548615 caatcttcattttttttttagtggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtctttaggtaaggttcatgggt 21548714  T
408 taggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaaaatttctcctaagagattcattgtgagtttgagtgacttggaaa 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21548715 taggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaaaatttctcctaagagattcattgtgagtttgagtgacttggaaa 21548814  T
508 atgggtaagggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagagatctactctcccccgga 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21548815 atgggtaagggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagagatctactctcccccgga 21548914  T
608 tgtaagataaattggtccaaactggat 634  Q
    |||||||||||||||||||||||||||    
21548915 tgtaagataaattggtccaaactggat 21548941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 478 - 591
Target Start/End: Original strand, 18912287 - 18912406
Alignment:
478 gattcattgtgagtttgagtgacttggaaaatgggta------agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactc 571  Q
    ||||||||||| |||||||||||||| ||||||| ||      ||||||||||||||||||  ||  ||| | |||||||| | ||| | ||||||||||    
18912287 gattcattgtgggtttgagtgacttgaaaaatggatataatttagggtttgttctttgtgagtttgtaaactaatttcttgtatcctttttgtatcactc 18912386  T
572 ttatcatagtggattagaga 591  Q
    ||||||||||||||| ||||    
18912387 ttatcatagtggattggaga 18912406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 332 - 390
Target Start/End: Complemental strand, 5370385 - 5370328
Alignment:
332 cttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    ||||||||||||||| ||||||||||| |||||||| |||||||||||| || ||||||    
5370385 cttgaagagagagaaacttgagaaatc-aaaggagacaactttagggtttagggtcttt 5370328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Complemental strand, 30000105 - 30000047
Alignment:
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| |||| |||||| |||||||| |||||||||||| || ||||||    
30000105 gcttgaagagagagaaacttgggaaatc-aaaggagacaactttagggtttagggtcttt 30000047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 390
Target Start/End: Complemental strand, 12739848 - 12739792
Alignment:
333 ttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||| ||||||||||| |||||||  |||||||||||| || ||||||    
12739848 ttgaagagagagaaacttgagaaatc-aaaggaggtaactttagggttgagggtcttt 12739792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 390
Target Start/End: Complemental strand, 12748054 - 12747998
Alignment:
333 ttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||| ||||||||||| |||||||  |||||||||||| || ||||||    
12748054 ttgaagagagagaaacttgagaaatc-aaaggaggtaactttagggttgagggtcttt 12747998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 515 - 591
Target Start/End: Original strand, 8114705 - 8114780
Alignment:
515 agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagaga 591  Q
    ||||||||||||||||||  ||| || | ||||||||| ||||| | | ||||| ||||||||||||||||| ||||    
8114705 agggtttgttctttgtgagattataagt-gatttcttgtaacctatttatatcattcttatcatagtggattggaga 8114780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 330 - 390
Target Start/End: Complemental strand, 9927758 - 9927699
Alignment:
330 ggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    ||||||||||||||||| |||| |||||| |||||||  |||||||||||| || ||||||    
9927758 ggcttgaagagagagaaacttgggaaatc-aaaggaggtaactttagggttgagggtcttt 9927699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 328 - 425
Target Start/End: Original strand, 23575170 - 23575267
Alignment:
328 gtggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtctttaggtaaggttcatgggttaggaaacacttcacaaa 425  Q
    |||||||||||||||||||||||  ||||   ||||||||||| ||||||||| |||||||||  || || |||||||||| | |||||||| |||||    
23575170 gtggcttgaagagagagaatctttggaaaagaaaaggagagaagtttagggttgagtgtctttgagtgagattcatgggttggaaaacacttgacaaa 23575267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 478 - 511
Target Start/End: Original strand, 31151066 - 31151099
Alignment:
478 gattcattgtgagtttgagtgacttggaaaatgg 511  Q
    ||||||||||||||||||||||||||||||||||    
31151066 gattcattgtgagtttgagtgacttggaaaatgg 31151099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 478 - 510
Target Start/End: Original strand, 31169355 - 31169387
Alignment:
478 gattcattgtgagtttgagtgacttggaaaatg 510  Q
    |||||||||||||||||||||||||||||||||    
31169355 gattcattgtgagtttgagtgacttggaaaatg 31169387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Complemental strand, 47676436 - 47676378
Alignment:
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| |||| |||||| |||||||| |||||||||||| || ||||||    
47676436 gcttgaagagagagaaacttgggaaatc-aaaggagataactttagggttgagggtcttt 47676378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 375 - 465
Target Start/End: Original strand, 4162575 - 4162665
Alignment:
375 agggttaagtgtctttaggtaaggttcatgggttaggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaaaa 465  Q
    |||||||||||||||||||| || ||  ||||||   ||| |||||||||| || ||||||  ||| |||||||| |||||||||| ||||    
4162575 agggttaagtgtctttaggtgagatttttgggttgataaatacttcacaaatatcttgggtagtgatatctcatttgagaaaggatgaaaa 4162665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 390
Target Start/End: Original strand, 29990925 - 29990981
Alignment:
333 ttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||| |||| |||||| |||||||| |||||||||||| || ||||||    
29990925 ttgaagagagagaaacttgggaaatc-aaaggagacaactttagggtttagggtcttt 29990981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 479 - 586
Target Start/End: Complemental strand, 11772112 - 11772000
Alignment:
479 attcattgtgagtttgagtgacttggaaaatgggtaa-----gggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactctt 573  Q
    |||||||| | |||||||||||||| |||| ||||||     || | ||||||||||||||||  ||| | |||||||  ||||||| ||||||||||||    
11772112 attcattgggggtttgagtgacttgaaaaaagggtaatattaggatatgttctttgtgaacttgtaaactaatttcttttaacctctttgtatcactctt 11772013  T
574 atcatagtggatt 586  Q
    |||||||||||||    
11772012 atcatagtggatt 11772000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 158
Target Start/End: Original strand, 40745174 - 40745216
Alignment:
116 aaatcgtgatgcgatttggtttagcaatttggaggttttggtt 158  Q
    ||||| || ||||||||||||||||||||||||||||||||||    
40745174 aaatcatggtgcgatttggtttagcaatttggaggttttggtt 40745216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Complemental strand, 3051453 - 3051395
Alignment:
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| |||| ||  | |||||||||||||||||||||| |||||||||    
3051453 gcttgaagagagagaaacttgggac-tataaaggagagaactttagggttgagtgtcttt 3051395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Original strand, 44303722 - 44303780
Alignment:
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| ||||||||||| |||||| | |||||||||||| || ||||||    
44303722 gcttgaagagagagaaacttgagaaatc-aaaggaaacaactttagggtttagggtcttt 44303780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 479 - 600
Target Start/End: Original strand, 1115029 - 1115156
Alignment:
479 attcattgtgagtttgagtgacttggaaaatgggta------agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactct 572  Q
    ||||||||||||| || |||||||| ||||||| ||      |||||||||| ||| ||| |||  || ||||||||||| ||||| | ||||||| |||    
1115029 attcattgtgagtgtgggtgacttgaaaaatggatagaaattagggtttgttatttttgagcttttaagttgatttcttgtaacctatttgtatcattct 1115128  T
573 tatcatagtggattagagatctactctc 600  Q
    |||||||||||||| ||||||| |||||    
1115129 tatcatagtggattggagatctgctctc 1115156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 517 - 591
Target Start/End: Original strand, 30518097 - 30518171
Alignment:
517 ggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagaga 591  Q
    ||||||||||||||||||||  || ||  |||| || ||||||| |||||||||||||||||||||||| |||||    
30518097 ggtttgttctttgtgaacttttaagttagtttcatgtaacctctttgtatcactcttatcatagtggatcagaga 30518171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 25173990 - 25173907
Alignment:
130 tttggtttagcaatttggaggttttggtttgcaaaatttcatggcacgaatgggagaactcatggtgcgatttgtggatcaagtt 214  Q
    ||||||| | |||||||||| ||||||||||||||||||| ||| |||| | |||||| ||||||| |||||| |||||||||||    
25173990 tttggttcaacaatttggagtttttggtttgcaaaatttcgtggaacgatttggagaaatcatggtacgattt-tggatcaagtt 25173907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 227
Target Start/End: Original strand, 34695122 - 34695231
Alignment:
117 aatcgtgatgcgatttggtttagcaatttggaggttttggtttgcaaaatttcatggcacgaatgggagaactcatggtgcgatttgtggatcaagttca 216  Q
    |||||||| ||||||||||| |||||||| ||||||||||||    ||| |||||||| | | |||||||| |||||||  ||||| ||| | |||||||    
34695122 aatcgtgacgcgatttggttgagcaatttagaggttttggttctagaaagttcatggcgcaattgggagaaatcatggtatgattt-tgggtgaagttca 34695220  T
217 atattgcactg 227  Q
    |||||| ||||    
34695221 atattgtactg 34695231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 515 - 591
Target Start/End: Original strand, 102461 - 102537
Alignment:
515 agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagaga 591  Q
    |||||||||| ||||||| |||  ||  | |||||||| ||||||| ||||||||||||||||| |||||| |||||    
102461 agggtttgttttttgtgagcttttaagataatttcttgtaacctctttgtatcactcttatcattgtggatcagaga 102537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Original strand, 114458 - 114516
Alignment:
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    |||||||||||||||| ||||||||||| |||||||  |||||||||||| || ||||||    
114458 gcttgaagagagagaaacttgagaaatc-aaaggaggtaactttagggttgagggtcttt 114516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000004; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 327 - 419
Target Start/End: Original strand, 41011605 - 41011696
Alignment:
327 agtggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtctttaggtaaggttcatgggttaggaaacactt 419  Q
    |||| ||| |||||||||||| |||| ||||| ||| ||| ||||||||   || ||||||||| |||||||||| | |||||||||||||||    
41011605 agtgccttcaagagagagaatattga-aaatccaaaagagggaactttaaaatttagtgtctttgggtaaggttcttaggttaggaaacactt 41011696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 331 - 390
Target Start/End: Original strand, 32636692 - 32636750
Alignment:
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttt 390  Q
    ||||| |||||||||| ||||||||||| |||||||  ||||||||||||||| ||||||    
32636692 gcttggagagagagaaacttgagaaatc-aaaggaggtaactttagggttaagggtcttt 32636750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 330 - 380
Target Start/End: Complemental strand, 9049656 - 9049607
Alignment:
330 ggcttgaagagagagaatcttgagaaatctaaaggagagaactttagggtt 380  Q
    ||||| ||||||||||| ||||||||||| |||||||| ||||||||||||    
9049656 ggcttcaagagagagaaacttgagaaatc-aaaggagataactttagggtt 9049607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 331 - 380
Target Start/End: Complemental strand, 42428730 - 42428682
Alignment:
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggtt 380  Q
    |||||||||||||||| |||| |||||| |||||||| ||||||||||||    
42428730 gcttgaagagagagaaacttgggaaatc-aaaggagataactttagggtt 42428682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000004; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 402 - 466
Target Start/End: Complemental strand, 39533151 - 39533087
Alignment:
402 atgggttaggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaaaat 466  Q
    ||||||| |||||||||||||||| | |||||||  ||| ||||||||| ||||| |||||||||    
39533151 atgggttgggaaacacttcacaaacacattgggtagtgagatctcattacagaaatgatcaaaat 39533087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 545 - 586
Target Start/End: Complemental strand, 5077831 - 5077790
Alignment:
545 atttcttgcaacctctgtgtatcactcttatcatagtggatt 586  Q
    |||||||| |||| || |||||||||||||||||||||||||    
5077831 atttcttgtaaccactttgtatcactcttatcatagtggatt 5077790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 331 - 391
Target Start/End: Complemental strand, 12633017 - 12632958
Alignment:
331 gcttgaagagagagaatcttgagaaatctaaaggagagaactttagggttaagtgtcttta 391  Q
    |||| ||||||||||| |||| |||| | |||||||| |||||||||||| ||||||||||    
12633017 gcttcaagagagagaaacttgggaaacc-aaaggagataactttagggttgagtgtcttta 12632958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 554 - 586
Target Start/End: Complemental strand, 39532983 - 39532951
Alignment:
554 aacctctgtgtatcactcttatcatagtggatt 586  Q
    ||||||| |||||||||||||||||||||||||    
39532983 aacctctatgtatcactcttatcatagtggatt 39532951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0076
Description:

Target: scaffold0076; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 545 - 590
Target Start/End: Original strand, 15985 - 16030
Alignment:
545 atttcttgcaacctctgtgtatcactcttatcatagtggattagag 590  Q
    |||||||| ||| ||| ||||| |||||||||||||||||||||||    
15985 atttcttgtaacatctttgtataactcttatcatagtggattagag 16030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0128 (Bit Score: 29; Significance: 0.000001; HSPs: 1)
Name: scaffold0128
Description:

Target: scaffold0128; HSP #1
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 403 - 463
Target Start/End: Original strand, 19402 - 19462
Alignment:
403 tgggttaggaaacacttcacaaaaatattgggttatgaaatctcattagagaaaggatcaa 463  Q
    |||||| |||||||||||| ||| || ||||||| ||| ||||| ||| ||||||||||||    
19402 tgggttgggaaacacttcagaaacattttgggttgtgagatctccttatagaaaggatcaa 19462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 515 - 591
Target Start/End: Original strand, 48382448 - 48382524
Alignment:
515 agggtttgttctttgtgaacttagaaattgatttcttgcaacctctgtgtatcactcttatcatagtggattagaga 591  Q
    |||||||| |||||||||||||  || || |||||||| ||||| | ||||||||| | |||||| |||||| ||||    
48382448 agggtttgatctttgtgaacttgtaagttaatttcttgtaacctatttgtatcactttcatcatattggattggaga 48382524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175762 times since January 2019
Visitors: 2679