View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-8 (Length: 635)

Name: F9350-LTR4-TNT-insertion-8
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9350-LTR4-TNT-insertion-8
F9350-LTR4-TNT-insertion-8
[»] chr4 (3 HSPs)
chr4 (10-625)||(9126014-9126629)
chr4 (79-129)||(9132576-9132626)
chr4 (270-372)||(9132359-9132458)


Alignment Details
Target: chr4 (Bit Score: 612; Significance: 0; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 612; E-Value: 0
Query Start/End: Original strand, 10 - 625
Target Start/End: Complemental strand, 9126629 - 9126014
Alignment:
10 acctttggtttagaagttaataattgcgccataatgtacattttataaccaatggtcctcttgaaaaaattattgattgattgaatcttgtcatccgcag 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
9126629 acctttggtttagaagttaataattgcgccataatgtacattttataaccaatggttctcttgaaaaaattattgattgattgaatcttgtcatccgcag 9126530  T
110 aatcttttgaggcgtgaggccgaggacgactgtcgtatcatgtagagatgttgatgaaatttacatcatggtcgtgaggcgtgagacactgaagctgcca 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9126529 aatcttttgaggcgtgaggccgaggacgactgtcgtatcatgtagagatgttgatgaaatttacatcatggtcgtgaggcgtgagacactgaagctgcca 9126430  T
210 agtaatgttcactaatggatgaggttgttttatctgttctagacttctagtttagtcacgtatcagtagaatgttggttattacaacagtactttcttta 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9126429 agtaatgttcactaatggatgaggttgttttatctgttctagacttctagtttagtcacgtatcagtagaatgttggttattacaacagtactttcttta 9126330  T
310 gttttgtaattgtttaaattgcatcgttttctagataatcatataacatagtacctctatcagcagtttgtatatatatccattgaaatggaatatggat 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9126329 gttttgtaattgtttaaattgcatcgttttctagataatcatataacatagtacctctatcagcagtttgtatatatatccattgaaatggaatatggat 9126230  T
410 gtttgataatatagaaaggttgatgaaatacaaatctatatcatgggatctgttttatttgatgtggcacatgtgattctttctagctctcaccttgctc 509  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9126229 gtttgataatatagaaaggttgatgaaatacaaatctatatcatgggatctgttttatttgatgtggcacatgtgattctttctagctctcaccttgctc 9126130  T
510 ctcatgattgttgttgactcaacatcttgttattttttgcctaattaaaagtttagatgagttgagcgactcgacgtctagttactgatactatgaaatt 609  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9126129 ctcatgattgttgttgactcaacatcttgttattttttgcctaattaaaagtttagatgagttgagcgactcgacgtctagttactgatactatgaaatt 9126030  T
610 gacttactatatatta 625  Q
    ||||||||||||||||    
9126029 gacttactatatatta 9126014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 79 - 129
Target Start/End: Complemental strand, 9132626 - 9132576
Alignment:
79 ttattgattgattgaatcttgtcatccgcagaatcttttgaggcgtgaggc 129  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||    
9132626 ttattgattgattgaatcttgtcatctgcagaatcttttgaggcgtgaggc 9132576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 270 - 372
Target Start/End: Complemental strand, 9132458 - 9132359
Alignment:
270 tatcagtagaatgttggttattacaacagtactttctttagttttgtaattgtttaaattgcatcgttttctagataatcatataacatagtacctctat 369  Q
    |||||||||||||||   |||| ||||||||||||||||||||||||| |||||| |||||| | |||||| ||| ||||| | |  |||||||||||||    
9132458 tatcagtagaatgtt---tattccaacagtactttctttagttttgtagttgtttgaattgctttgttttccagaaaatcaaagacaatagtacctctat 9132362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37732 times since January 2019
Visitors: 1597