View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9350-LTR4-TNT-insertion-8 (Length: 635)

Name: F9350-LTR4-TNT-insertion-8
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9350-LTR4-TNT-insertion-8
[»] chr4 (3 HSPs)
chr4 (10-625)||(9126014-9126629)
chr4 (79-129)||(9132576-9132626)
chr4 (270-372)||(9132359-9132458)

Alignment Details
Target: chr4 (Bit Score: 612; Significance: 0; HSPs: 3)
Name: chr4

Target: chr4; HSP #1
Raw Score: 612; E-Value: 0
Query Start/End: Original strand, 10 - 625
Target Start/End: Complemental strand, 9126629 - 9126014
10 acctttggtttagaagttaataattgcgccataatgtacattttataaccaatggtcctcttgaaaaaattattgattgattgaatcttgtcatccgcag 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
9126629 acctttggtttagaagttaataattgcgccataatgtacattttataaccaatggttctcttgaaaaaattattgattgattgaatcttgtcatccgcag 9126530  T
110 aatcttttgaggcgtgaggccgaggacgactgtcgtatcatgtagagatgttgatgaaatttacatcatggtcgtgaggcgtgagacactgaagctgcca 209  Q
9126529 aatcttttgaggcgtgaggccgaggacgactgtcgtatcatgtagagatgttgatgaaatttacatcatggtcgtgaggcgtgagacactgaagctgcca 9126430  T
210 agtaatgttcactaatggatgaggttgttttatctgttctagacttctagtttagtcacgtatcagtagaatgttggttattacaacagtactttcttta 309  Q
9126429 agtaatgttcactaatggatgaggttgttttatctgttctagacttctagtttagtcacgtatcagtagaatgttggttattacaacagtactttcttta 9126330  T
310 gttttgtaattgtttaaattgcatcgttttctagataatcatataacatagtacctctatcagcagtttgtatatatatccattgaaatggaatatggat 409  Q
9126329 gttttgtaattgtttaaattgcatcgttttctagataatcatataacatagtacctctatcagcagtttgtatatatatccattgaaatggaatatggat 9126230  T
410 gtttgataatatagaaaggttgatgaaatacaaatctatatcatgggatctgttttatttgatgtggcacatgtgattctttctagctctcaccttgctc 509  Q
9126229 gtttgataatatagaaaggttgatgaaatacaaatctatatcatgggatctgttttatttgatgtggcacatgtgattctttctagctctcaccttgctc 9126130  T
510 ctcatgattgttgttgactcaacatcttgttattttttgcctaattaaaagtttagatgagttgagcgactcgacgtctagttactgatactatgaaatt 609  Q
9126129 ctcatgattgttgttgactcaacatcttgttattttttgcctaattaaaagtttagatgagttgagcgactcgacgtctagttactgatactatgaaatt 9126030  T
610 gacttactatatatta 625  Q
9126029 gacttactatatatta 9126014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 79 - 129
Target Start/End: Complemental strand, 9132626 - 9132576
79 ttattgattgattgaatcttgtcatccgcagaatcttttgaggcgtgaggc 129  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||    
9132626 ttattgattgattgaatcttgtcatctgcagaatcttttgaggcgtgaggc 9132576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 270 - 372
Target Start/End: Complemental strand, 9132458 - 9132359
270 tatcagtagaatgttggttattacaacagtactttctttagttttgtaattgtttaaattgcatcgttttctagataatcatataacatagtacctctat 369  Q
    |||||||||||||||   |||| ||||||||||||||||||||||||| |||||| |||||| | |||||| ||| ||||| | |  |||||||||||||    
9132458 tatcagtagaatgtt---tattccaacagtactttctttagttttgtagttgtttgaattgctttgttttccagaaaatcaaagacaatagtacctctat 9132362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175628 times since January 2019
Visitors: 2679