View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9353-LTR4-TNT-insertion-2 (Length: 241)

Name: F9353-LTR4-TNT-insertion-2
Description: F9353-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9353-LTR4-TNT-insertion-2
[»] chr7 (1 HSPs)
chr7 (10-231)||(31422490-31422711)

Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 231
Target Start/End: Original strand, 31422490 - 31422711
10 aattgttgggtcagaacgattagatggagaataaccctgcatcaatatctaatgttttcatcttgtcaaaacnnnnnnnntctaatgttttcaccataat 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||    
31422490 aattgttgggtcagaacgattagatggagaataaccctgcatcaatatctaatgttttcatcttgtcaaaacaaaaaaaatctaatgttttcaccataat 31422589  T
110 ttattcacatgaagagcgtatagtgcatcttcaaggggagcattgtctctgaatggatcacctttctgctatggtaaacaaacataaatactcaaatgtg 209  Q
31422590 ttattcacatgaagagcgtatagtgcatcttcaaggggagcattgtctctgaatggatcacctttctgctatggtaaacaaacataaatactcaaatgtg 31422689  T
210 atcacgttatctaaaagcatta 231  Q
31422690 atcacgttatctaaaagcatta 31422711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295807 times since January 2019
Visitors: 3016