View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9353-LTR4-TNT-insertion-3 (Length: 437)

Name: F9353-LTR4-TNT-insertion-3
Description: F9353-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9353-LTR4-TNT-insertion-3
F9353-LTR4-TNT-insertion-3
[»] chr4 (70 HSPs)
chr4 (10-427)||(54963435-54963852)
chr4 (125-214)||(51438642-51438732)
chr4 (125-204)||(35690478-35690558)
chr4 (127-214)||(45204837-45204924)
chr4 (125-214)||(19154858-19154948)
chr4 (125-214)||(55007943-55008033)
chr4 (127-223)||(436417-436514)
chr4 (130-214)||(23906297-23906382)
chr4 (127-214)||(29399001-29399089)
chr4 (127-214)||(52569512-52569600)
chr4 (125-211)||(19061930-19062017)
chr4 (125-214)||(13805260-13805350)
chr4 (125-214)||(25575021-25575111)
chr4 (125-191)||(30634101-30634167)
chr4 (125-214)||(48174088-48174178)
chr4 (126-215)||(53540486-53540576)
chr4 (130-214)||(31959814-31959899)
chr4 (125-178)||(44719356-44719409)
chr4 (130-214)||(48622543-48622628)
chr4 (127-214)||(12494860-12494948)
chr4 (129-185)||(15665328-15665384)
chr4 (131-210)||(26024851-26024931)
chr4 (131-214)||(26037506-26037590)
chr4 (127-214)||(28236379-28236467)
chr4 (127-214)||(34208266-34208354)
chr4 (125-216)||(37488286-37488378)
chr4 (127-214)||(39100533-39100621)
chr4 (125-204)||(45209200-45209280)
chr4 (125-192)||(50238610-50238677)
chr4 (125-192)||(50238696-50238763)
chr4 (129-214)||(1777016-1777102)
chr4 (125-214)||(4441050-4441140)
chr4 (125-214)||(8286636-8286726)
chr4 (129-214)||(20601651-20601737)
chr4 (125-214)||(21237055-21237145)
chr4 (125-183)||(21528517-21528575)
chr4 (137-214)||(39708630-39708708)
chr4 (125-214)||(53518319-53518408)
chr4 (129-214)||(56375487-56375573)
chr4 (126-214)||(5306493-5306582)
chr4 (125-178)||(46153942-46153995)
chr4 (131-214)||(4548219-4548303)
chr4 (125-204)||(6957805-6957885)
chr4 (127-214)||(19969378-19969466)
chr4 (127-175)||(20654875-20654923)
chr4 (126-178)||(31459228-31459280)
chr4 (129-216)||(32479233-32479321)
chr4 (125-173)||(36556755-36556803)
chr4 (129-192)||(46715265-46715329)
chr4 (132-214)||(1095642-1095725)
chr4 (125-184)||(1211387-1211446)
chr4 (125-215)||(2589268-2589359)
chr4 (125-192)||(15661867-15661934)
chr4 (125-192)||(26275011-26275078)
chr4 (129-168)||(30662042-30662081)
chr4 (126-165)||(51051451-51051490)
chr4 (127-178)||(56130404-56130455)
chr4 (125-175)||(7066494-7066544)
chr4 (130-223)||(36799657-36799751)
chr4 (129-202)||(49939733-49939807)
chr4 (128-185)||(25427860-25427917)
chr4 (130-202)||(27450180-27450253)
chr4 (130-214)||(29209175-29209260)
chr4 (127-168)||(50869877-50869918)
chr4 (125-185)||(1328609-1328669)
chr4 (126-166)||(8327147-8327187)
chr4 (129-212)||(22420716-22420800)
chr4 (125-157)||(25959222-25959254)
chr4 (127-175)||(45184130-45184178)
chr4 (125-165)||(49454474-49454514)
[»] chr6 (26 HSPs)
chr6 (126-214)||(34501-34590)
chr6 (127-214)||(12890772-12890860)
chr6 (130-214)||(34934830-34934915)
chr6 (125-214)||(3206454-3206544)
chr6 (125-214)||(28085573-28085663)
chr6 (133-214)||(30031453-30031535)
chr6 (130-214)||(9706967-9707052)
chr6 (130-216)||(5096029-5096116)
chr6 (125-214)||(34143760-34143850)
chr6 (125-214)||(34156376-34156466)
chr6 (128-216)||(5897652-5897741)
chr6 (126-214)||(32756118-32756207)
chr6 (131-183)||(608390-608442)
chr6 (127-214)||(31819028-31819116)
chr6 (125-215)||(4245867-4245958)
chr6 (125-192)||(5258143-5258210)
chr6 (130-185)||(33730192-33730247)
chr6 (129-210)||(8364757-8364839)
chr6 (129-213)||(9593709-9593792)
chr6 (125-183)||(10098891-10098949)
chr6 (131-160)||(6800642-6800671)
chr6 (127-160)||(10422703-10422736)
chr6 (133-205)||(21089603-21089676)
chr6 (132-168)||(4949788-4949824)
chr6 (132-168)||(4956759-4956795)
chr6 (130-178)||(6906827-6906875)
[»] chr1 (74 HSPs)
chr1 (125-214)||(28090689-28090779)
chr1 (129-214)||(8796406-8796492)
chr1 (125-214)||(25979226-25979316)
chr1 (126-205)||(1704833-1704913)
chr1 (124-203)||(7133296-7133376)
chr1 (127-214)||(38807668-38807756)
chr1 (127-214)||(41560426-41560514)
chr1 (128-214)||(44941774-44941861)
chr1 (125-214)||(30202125-30202215)
chr1 (127-214)||(1210942-1211030)
chr1 (125-216)||(6084170-6084262)
chr1 (125-192)||(26299288-26299355)
chr1 (132-214)||(37462878-37462961)
chr1 (130-216)||(40568410-40568497)
chr1 (125-183)||(4029351-4029409)
chr1 (130-223)||(25715326-25715420)
chr1 (128-209)||(29577454-29577536)
chr1 (125-214)||(51602253-51602343)
chr1 (130-214)||(21769711-21769796)
chr1 (126-214)||(39318326-39318414)
chr1 (130-214)||(49347393-49347478)
chr1 (128-216)||(52532614-52532703)
chr1 (130-214)||(52921277-52921362)
chr1 (127-214)||(4707218-4707305)
chr1 (127-214)||(37311752-37311840)
chr1 (125-185)||(43481793-43481853)
chr1 (127-214)||(44751681-44751769)
chr1 (127-214)||(48431396-48431484)
chr1 (132-214)||(1290033-1290116)
chr1 (130-204)||(28533674-28533749)
chr1 (128-214)||(34792347-34792434)
chr1 (130-216)||(50257765-50257852)
chr1 (130-223)||(2544781-2544875)
chr1 (125-167)||(7922070-7922112)
chr1 (125-214)||(22175342-22175432)
chr1 (126-216)||(28511793-28511888)
chr1 (125-214)||(31274396-31274486)
chr1 (125-214)||(34444553-34444643)
chr1 (129-214)||(51440764-51440850)
chr1 (130-183)||(4380189-4380241)
chr1 (146-214)||(19908051-19908120)
chr1 (127-211)||(26113436-26113521)
chr1 (130-214)||(42337753-42337838)
chr1 (127-214)||(10200303-10200391)
chr1 (127-214)||(11584194-11584282)
chr1 (127-214)||(19936657-19936745)
chr1 (127-214)||(22090293-22090381)
chr1 (125-177)||(38758015-38758067)
chr1 (131-214)||(43240380-43240464)
chr1 (128-223)||(50846750-50846846)
chr1 (125-192)||(2914118-2914185)
chr1 (128-214)||(6025802-6025889)
chr1 (128-214)||(9592931-9593018)
chr1 (128-210)||(32404525-32404607)
chr1 (125-192)||(41165502-41165569)
chr1 (125-183)||(4318840-4318898)
chr1 (131-212)||(4590533-4590615)
chr1 (129-163)||(17640066-17640100)
chr1 (125-166)||(8809496-8809537)
chr1 (132-177)||(10674730-10674775)
chr1 (126-183)||(15086151-15086208)
chr1 (146-214)||(19908400-19908469)
chr1 (126-175)||(26016674-26016723)
chr1 (134-214)||(27072491-27072572)
chr1 (125-204)||(27704157-27704238)
chr1 (130-214)||(35828562-35828647)
chr1 (128-212)||(38869081-38869166)
chr1 (125-158)||(42340108-42340141)
chr1 (131-184)||(52561590-52561643)
chr1 (128-214)||(696466-696554)
chr1 (133-193)||(7210930-7210990)
chr1 (127-214)||(27847797-27847885)
chr1 (127-183)||(32082753-32082809)
chr1 (126-158)||(50425309-50425341)
[»] chr5 (49 HSPs)
chr5 (125-216)||(6859576-6859668)
chr5 (129-214)||(18855804-18855890)
chr5 (125-214)||(4496581-4496671)
chr5 (129-214)||(5558338-5558424)
chr5 (126-211)||(14667971-14668057)
chr5 (127-204)||(42576217-42576295)
chr5 (125-214)||(14665911-14665999)
chr5 (130-214)||(16347380-16347463)
chr5 (127-214)||(29816579-29816667)
chr5 (128-210)||(11069160-11069243)
chr5 (128-214)||(11675727-11675814)
chr5 (125-214)||(10639499-10639589)
chr5 (125-214)||(12492379-12492469)
chr5 (125-214)||(28976854-28976944)
chr5 (125-214)||(30213772-30213862)
chr5 (128-185)||(7359259-7359316)
chr5 (138-214)||(9235244-9235320)
chr5 (129-201)||(42272687-42272760)
chr5 (125-204)||(2915491-2915571)
chr5 (129-204)||(38132543-38132619)
chr5 (125-185)||(41894300-41894360)
chr5 (137-214)||(38685164-38685242)
chr5 (127-223)||(1275452-1275549)
chr5 (130-214)||(3302041-3302126)
chr5 (128-192)||(408492-408556)
chr5 (125-216)||(683696-683788)
chr5 (125-185)||(4653479-4653539)
chr5 (128-211)||(13561384-13561468)
chr5 (129-192)||(2090633-2090696)
chr5 (128-210)||(5860035-5860118)
chr5 (125-168)||(29929298-29929341)
chr5 (131-204)||(20456980-20457054)
chr5 (130-192)||(27386560-27386622)
chr5 (125-214)||(32442121-32442210)
chr5 (129-214)||(35118321-35118407)
chr5 (126-214)||(79710-79799)
chr5 (129-178)||(7678711-7678760)
chr5 (125-201)||(29922494-29922571)
chr5 (128-161)||(35720626-35720659)
chr5 (127-160)||(36123179-36123212)
chr5 (130-214)||(43557833-43557918)
chr5 (127-214)||(418031-418119)
chr5 (165-216)||(6889188-6889240)
chr5 (133-216)||(7640510-7640594)
chr5 (131-214)||(12576861-12576945)
chr5 (125-216)||(26884684-26884776)
chr5 (127-175)||(28411913-28411961)
chr5 (129-185)||(36551373-36551429)
chr5 (127-214)||(38830517-38830604)
[»] chr8 (53 HSPs)
chr8 (130-216)||(35914601-35914688)
chr8 (125-214)||(490532-490622)
chr8 (124-214)||(42469721-42469812)
chr8 (125-214)||(32931157-32931247)
chr8 (125-214)||(44047527-44047617)
chr8 (127-214)||(11523720-11523808)
chr8 (128-201)||(1928585-1928659)
chr8 (133-214)||(12491141-12491223)
chr8 (125-202)||(14742077-14742155)
chr8 (125-213)||(21121344-21121432)
chr8 (130-214)||(44529422-44529507)
chr8 (129-213)||(45041315-45041400)
chr8 (130-214)||(45419432-45419517)
chr8 (133-204)||(1313771-1313843)
chr8 (125-204)||(27556297-27556377)
chr8 (127-214)||(36545346-36545434)
chr8 (126-216)||(14903756-14903847)
chr8 (128-214)||(36565239-36565326)
chr8 (129-214)||(25473402-25473488)
chr8 (130-214)||(29520846-29520931)
chr8 (125-166)||(32978120-32978161)
chr8 (128-185)||(39651026-39651083)
chr8 (124-185)||(41031414-41031475)
chr8 (124-185)||(41031520-41031581)
chr8 (125-177)||(1064955-1065007)
chr8 (126-166)||(16008391-16008431)
chr8 (130-214)||(26363684-26363768)
chr8 (131-214)||(35362651-35362735)
chr8 (127-214)||(42584556-42584643)
chr8 (128-214)||(23492231-23492318)
chr8 (128-183)||(30748692-30748747)
chr8 (125-203)||(32276893-32276972)
chr8 (127-178)||(35085134-35085185)
chr8 (128-214)||(35323970-35324057)
chr8 (125-160)||(39947100-39947135)
chr8 (132-214)||(16917380-16917462)
chr8 (129-175)||(39953263-39953309)
chr8 (125-183)||(40813553-40813611)
chr8 (133-214)||(44699663-44699745)
chr8 (132-185)||(1335553-1335606)
chr8 (125-166)||(1489755-1489796)
chr8 (125-166)||(5205421-5205462)
chr8 (125-166)||(24837937-24837978)
chr8 (125-178)||(26642736-26642789)
chr8 (125-158)||(32569705-32569738)
chr8 (125-214)||(35643603-35643691)
chr8 (125-178)||(36394943-36394996)
chr8 (128-184)||(3473798-3473854)
chr8 (147-214)||(16035744-16035812)
chr8 (125-185)||(18741859-18741919)
chr8 (125-185)||(18746823-18746883)
chr8 (128-160)||(31309605-31309637)
chr8 (130-166)||(32838891-32838927)
[»] chr3 (53 HSPs)
chr3 (125-214)||(48508432-48508522)
chr3 (125-201)||(45374472-45374549)
chr3 (125-216)||(40991626-40991718)
chr3 (125-214)||(5169029-5169119)
chr3 (125-214)||(12096700-12096790)
chr3 (129-214)||(54128576-54128662)
chr3 (127-223)||(2133609-2133706)
chr3 (130-214)||(38060911-38060996)
chr3 (125-214)||(7895875-7895965)
chr3 (125-214)||(47555327-47555417)
chr3 (125-214)||(52927843-52927933)
chr3 (125-214)||(53262338-53262428)
chr3 (146-214)||(24541348-24541417)
chr3 (130-214)||(38850318-38850403)
chr3 (129-213)||(45486848-45486933)
chr3 (130-210)||(48734147-48734228)
chr3 (127-192)||(49503565-49503630)
chr3 (125-212)||(311304-311392)
chr3 (125-216)||(25191572-25191664)
chr3 (125-216)||(42510011-42510103)
chr3 (127-214)||(52156081-52156169)
chr3 (130-212)||(14415260-14415342)
chr3 (128-214)||(19676079-19676166)
chr3 (127-214)||(37534200-37534287)
chr3 (128-214)||(52138997-52139084)
chr3 (125-214)||(22269-22359)
chr3 (125-175)||(3987571-3987621)
chr3 (126-204)||(31146907-31146985)
chr3 (125-214)||(39208805-39208895)
chr3 (133-214)||(49841813-49841895)
chr3 (129-182)||(39512773-39512826)
chr3 (130-214)||(40106620-40106705)
chr3 (130-214)||(45289091-45289176)
chr3 (127-214)||(29601089-29601177)
chr3 (129-204)||(46148235-46148311)
chr3 (125-211)||(40273200-40273287)
chr3 (133-192)||(41529981-41530040)
chr3 (127-204)||(48532164-48532243)
chr3 (130-204)||(49042144-49042219)
chr3 (125-168)||(51027794-51027837)
chr3 (127-185)||(344769-344827)
chr3 (125-214)||(388257-388347)
chr3 (130-211)||(31566161-31566243)
chr3 (126-192)||(45834596-45834662)
chr3 (130-183)||(7278693-7278746)
chr3 (130-202)||(24778609-24778682)
chr3 (130-214)||(47233596-47233681)
chr3 (126-183)||(53519809-53519866)
chr3 (130-201)||(15296117-15296189)
chr3 (146-213)||(19758085-19758152)
chr3 (128-160)||(30704104-30704136)
chr3 (129-204)||(37083291-37083367)
chr3 (127-214)||(51447714-51447802)
[»] chr7 (65 HSPs)
chr7 (126-214)||(9210700-9210789)
chr7 (125-214)||(28208323-28208413)
chr7 (127-216)||(36101774-36101864)
chr7 (130-214)||(40979928-40980013)
chr7 (127-214)||(2885719-2885807)
chr7 (125-214)||(12841270-12841360)
chr7 (125-209)||(31682597-31682682)
chr7 (126-214)||(39906368-39906457)
chr7 (127-209)||(42187642-42187726)
chr7 (127-214)||(11594157-11594245)
chr7 (127-214)||(45836479-45836567)
chr7 (129-214)||(27648977-27649063)
chr7 (125-214)||(27893558-27893648)
chr7 (133-214)||(28627936-28628018)
chr7 (125-214)||(29650581-29650671)
chr7 (125-214)||(43491505-43491595)
chr7 (125-204)||(4604754-4604834)
chr7 (125-204)||(6375075-6375155)
chr7 (131-214)||(14057675-14057759)
chr7 (131-214)||(14367703-14367787)
chr7 (127-214)||(43281871-43281959)
chr7 (120-192)||(44855164-44855236)
chr7 (130-185)||(20158671-20158726)
chr7 (125-223)||(36652180-36652279)
chr7 (128-214)||(37618142-37618229)
chr7 (146-212)||(48515370-48515437)
chr7 (125-214)||(22349817-22349907)
chr7 (128-216)||(28355360-28355450)
chr7 (127-185)||(29318792-29318850)
chr7 (125-183)||(31005434-31005492)
chr7 (125-214)||(32631761-32631851)
chr7 (125-214)||(34035149-34035239)
chr7 (125-214)||(38900154-38900243)
chr7 (129-213)||(1011244-1011329)
chr7 (127-192)||(28708601-28708666)
chr7 (127-192)||(29312209-29312274)
chr7 (130-214)||(34869617-34869702)
chr7 (132-192)||(6263479-6263539)
chr7 (133-216)||(45601671-45601755)
chr7 (126-178)||(45840992-45841044)
chr7 (128-167)||(29012335-29012374)
chr7 (125-223)||(35713883-35713981)
chr7 (125-192)||(40630654-40630721)
chr7 (125-168)||(47413710-47413753)
chr7 (129-214)||(7273297-7273383)
chr7 (125-175)||(14593989-14594039)
chr7 (125-175)||(16013512-16013562)
chr7 (128-213)||(25891086-25891172)
chr7 (129-183)||(31869101-31869155)
chr7 (130-214)||(33732031-33732114)
chr7 (135-204)||(33871479-33871549)
chr7 (137-214)||(35906208-35906286)
chr7 (125-214)||(38607189-38607279)
chr7 (125-206)||(40008426-40008508)
chr7 (128-178)||(41483721-41483771)
chr7 (125-214)||(42969895-42969985)
chr7 (129-214)||(47652744-47652830)
chr7 (127-185)||(48515502-48515560)
chr7 (127-192)||(5418294-5418359)
chr7 (126-167)||(6807736-6807777)
chr7 (125-178)||(36869232-36869285)
chr7 (126-213)||(33103124-33103212)
chr7 (124-168)||(33650864-33650908)
chr7 (143-214)||(34926535-34926607)
chr7 (126-166)||(43423987-43424027)
[»] chr2 (64 HSPs)
chr2 (124-214)||(3481351-3481442)
chr2 (131-216)||(18959106-18959192)
chr2 (127-214)||(9531597-9531685)
chr2 (125-214)||(227386-227476)
chr2 (125-214)||(3635318-3635408)
chr2 (128-213)||(12520060-12520146)
chr2 (125-214)||(12734897-12734987)
chr2 (126-214)||(30306229-30306318)
chr2 (130-214)||(31959718-31959803)
chr2 (134-214)||(33504421-33504502)
chr2 (127-214)||(9496063-9496151)
chr2 (127-214)||(25834875-25834963)
chr2 (125-176)||(8560801-8560852)
chr2 (125-203)||(38328365-38328444)
chr2 (125-192)||(43573125-43573192)
chr2 (129-214)||(28508875-28508961)
chr2 (131-216)||(39709202-39709288)
chr2 (125-204)||(451643-451723)
chr2 (127-214)||(2610785-2610873)
chr2 (127-214)||(7326157-7326245)
chr2 (130-209)||(12474927-12475007)
chr2 (130-213)||(18424378-18424461)
chr2 (127-201)||(4807805-4807880)
chr2 (125-192)||(17670688-17670755)
chr2 (125-214)||(3866269-3866359)
chr2 (125-214)||(12882040-12882130)
chr2 (125-183)||(43832327-43832385)
chr2 (126-214)||(8197537-8197626)
chr2 (126-214)||(8202297-8202386)
chr2 (129-213)||(9394629-9394714)
chr2 (130-202)||(11992108-11992181)
chr2 (130-210)||(17429251-17429332)
chr2 (129-213)||(19863432-19863517)
chr2 (129-213)||(19867764-19867849)
chr2 (129-213)||(19872665-19872750)
chr2 (127-204)||(33393317-33393394)
chr2 (126-214)||(35643145-35643234)
chr2 (126-214)||(35755241-35755330)
chr2 (130-204)||(3030886-3030960)
chr2 (131-209)||(3243654-3243733)
chr2 (130-192)||(32443856-32443919)
chr2 (127-209)||(42549834-42549917)
chr2 (130-192)||(10516749-10516811)
chr2 (129-214)||(13443907-13443993)
chr2 (126-215)||(44437717-44437807)
chr2 (133-214)||(45077926-45078008)
chr2 (126-214)||(6219162-6219251)
chr2 (124-165)||(13188389-13188430)
chr2 (125-162)||(15025744-15025781)
chr2 (132-212)||(34931631-34931712)
chr2 (124-157)||(36608676-36608709)
chr2 (130-214)||(38435149-38435234)
chr2 (125-213)||(41197222-41197311)
chr2 (130-183)||(41763043-41763096)
chr2 (128-215)||(7431887-7431975)
chr2 (127-214)||(12141741-12141829)
chr2 (127-175)||(12489799-12489847)
chr2 (125-177)||(15775840-15775892)
chr2 (125-177)||(17626307-17626359)
chr2 (125-185)||(24214013-24214073)
chr2 (125-200)||(25384680-25384756)
chr2 (127-214)||(33287618-33287706)
chr2 (130-178)||(38452686-38452734)
chr2 (147-214)||(45543090-45543158)
[»] scaffold0168 (1 HSPs)
scaffold0168 (125-214)||(28884-28974)
[»] scaffold0570 (1 HSPs)
scaffold0570 (126-214)||(944-1033)
[»] scaffold0050 (1 HSPs)
scaffold0050 (127-212)||(58223-58309)
[»] scaffold0692 (1 HSPs)
scaffold0692 (127-214)||(4833-4921)
[»] scaffold0157 (1 HSPs)
scaffold0157 (127-214)||(25529-25617)
[»] scaffold0392 (1 HSPs)
scaffold0392 (124-214)||(6766-6857)
[»] scaffold0245 (1 HSPs)
scaffold0245 (132-214)||(16438-16521)
[»] scaffold1318 (1 HSPs)
scaffold1318 (129-214)||(528-614)
[»] scaffold0199 (1 HSPs)
scaffold0199 (125-214)||(14780-14870)
[»] scaffold0018 (1 HSPs)
scaffold0018 (126-183)||(31697-31754)
[»] scaffold0024 (1 HSPs)
scaffold0024 (133-214)||(48119-48201)
[»] scaffold0041 (1 HSPs)
scaffold0041 (130-214)||(16775-16860)
[»] scaffold0491 (1 HSPs)
scaffold0491 (125-185)||(3664-3724)
[»] scaffold0010 (1 HSPs)
scaffold0010 (131-214)||(160325-160409)


Alignment Details
Target: chr4 (Bit Score: 418; Significance: 0; HSPs: 70)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 418; E-Value: 0
Query Start/End: Original strand, 10 - 427
Target Start/End: Complemental strand, 54963852 - 54963435
Alignment:
10 cggacaacatggtagaatatacagagaaaaagtaaaatagaaacttgatagaatttggatcatgcgcacaagaaagtaacgcacaccaaaaaactttgtc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54963852 cggacaacatggtagaatatacagagaaaaagtaaaatagaaacttgatagaatttggatcatgcgcacaagaaagtaacgcacaccaaaaaactttgtc 54963753  T
110 tatctaaaatgatcgcaacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatatacca 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54963752 tatctaaaatgatcgcaacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatatacca 54963653  T
210 tattttgcttcaacatcaactcaggccacataacaaataagaaatggcacaacaacatgaatcaatcaatgaataacatagaaatgagagattaaaaaga 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54963652 tattttgcttcaacatcaactcaggccacataacaaataagaaatggcacaacaacatgaatcaatcaatgaataacatagaaatgagagattaaaaaga 54963553  T
310 acctgagcatgaagtatgcaatcacggcctgagaaaagacgaggcaatgcttgtttctggaccggtgtaggcatgacatatccaacttcttccatcctga 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54963552 acctgagcatgaagtatgcaatcacggcctgagaaaagacgaggcaatgcttgtttctggaccggtgtaggcatgacatatccaacttcttccatcctga 54963453  T
410 aaccatattacaaaatta 427  Q
    ||||||||||||||||||    
54963452 aaccatattacaaaatta 54963435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 51438732 - 51438642
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| |||||||||| |||||||||||| ||||||||| |||||| ||||| ||||| ||| ||| |||||||||    
51438732 caacaacaacaacaaccaagccttatcccacaaagttgggtcagctacatggatcaaattacgccataatgttatattataaaccatattt 51438642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 125 - 204
Target Start/End: Complemental strand, 35690558 - 35690478
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||||| ||| ||||||||||||||||||| ||||| | ||||||||| |||||| ||||| |||||||||||||    
35690558 caacaacaacaaaaaccaagtcttatcccactaagtggggtcggctacatggatcaaattacgccataatgttctatcata 35690478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 45204837 - 45204924
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||||||||  | ||||| ||| |||||| |||  ||||||||||||| |||||||||    
45204837 acaacaacaacaaccaagccttatcccactaagttgggtgggctacatagatcaaattacgcctaatgttctatcataaaccatattt 45204924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 19154858 - 19154948
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||||| | ||||||| |||| | |||||| |||||||||||| |||| ||||    
19154858 caacaacaacaacaaccaagccttatcccactaagtggggtcagctgcatggatcaaataacgccatagtgttctatcataaaccaaattt 19154948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 55008033 - 55007943
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| | ||| ||| ||||||||| |||||||||    
55008033 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgtcataatgatctatcataaaccatattt 55007943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 127 - 223
Target Start/End: Complemental strand, 436514 - 436417
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttgcttcaac 223  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| |||| | ||||||    
436514 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgatgccatagtgttctatcatacaccaaatttggattcaac 436417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 23906297 - 23906382
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||||| ||||||||| |||| | |||||| |||||||||||| |||| ||||    
23906297 acaacaacaaccaagccttatcccactaagtggggtcagctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 23906382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 29399089 - 29399001
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||| ||||||||||| ||||||| |||||| || |||||| ||||| ||||||||||||| ||| |||||    
29399089 acaacaacaacaaccaagccttttcccactaagtggggtcagctacatgaatcaaattacgccataatgttctatcataaaccttattt 29399001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 52569512 - 52569600
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
52569512 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 52569600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 125 - 211
Target Start/End: Original strand, 19061930 - 19062017
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccata 211  Q
    |||||||||||||||| ||| |||||||||||| || ||||| | ||||||||| |||| | |||||| |||||||||||| ||||||    
19061930 caacaacaacaacaaccaagccttatcccactaggtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccata 19062017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 13805260 - 13805350
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| | ||||||||||||| ||||  | ||||||||| ||||||  |||| ||||||||||||| |||||||||    
13805260 caacaacaacaacaaccaagccatatcccactaagtggggttggctacatggatcaaattatcccataatgttctatcataaaccatattt 13805350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 25575111 - 25575021
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggcca-tatgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||| | ||||| | ||||||||| ||||||  |||  ||||||||||||| |||||||||    
25575111 caacaacaacaacaaccaagccttatcccactaaatggggtctgctacatggatcaaattacaccacaatgttctatcataaaccatattt 25575021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 191
Target Start/End: Original strand, 30634101 - 30634167
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat 191  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||||    
30634101 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccat 30634167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 48174088 - 48174178
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | ||||| ||||| ||||||| |||| ||||    
48174088 caacaacaacaacaaccaagccttatcccactaagtggggtctgctacatggatcaaatgacgccataatgttttatcatacaccaaattt 48174178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 126 - 215
Target Start/End: Complemental strand, 53540576 - 53540486
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatatttt 215  Q
    |||||||| |||||| ||||||||||||||| ||| ||||  | || |||||| |||||| ||||| ||||||||||||| ||||||||||    
53540576 aacaacaataacaaccaagtcttatcccactcagtggggttggctatatggatcaaattatgccataatgttctatcataaaccatatttt 53540486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 31959814 - 31959899
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
31959814 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 31959899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 44719356 - 44719409
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    |||||||||||||||| ||||||||||||||||||| ||||| | |||||||||    
44719356 caacaacaacaacaaccaagtcttatcccactaagtagggtcggctacatggat 44719409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 48622543 - 48622628
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
48622543 acaacaacaaccaagccttatcccactaagtggggtcggctacatggattaaatgacgccatagtgttctatcatacaccaaattt 48622628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 12494948 - 12494860
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | | |||| |||||||||||| |||| ||||    
12494948 acaacaacaacaaccaagccttatcccactaagtggggtccgctacatggattaaatgacgtcatagtgttctatcatacaccaaattt 12494860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 15665384 - 15665328
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||||||||| ||| ||||||||||||||| ||||||| ||||||||| ||||||    
15665384 aacaacaacaaccaagccttatcccactaagtggggtcagctacatggatcaaatta 15665328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 131 - 210
Target Start/End: Original strand, 26024851 - 26024931
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccat 210  Q
    |||||||||| ||| |||||||||||||||  |||| | ||||||||||||||||  |||| ||||||||||||| |||||    
26024851 caacaacaaccaagccttatcccactaagtgaggtcggctacatggataaaattacaccataatgttctatcataaaccat 26024931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 131 - 214
Target Start/End: Original strand, 26037506 - 26037590
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||| ||  ||||||||||||||| ||||| | |||||||||  ||||| |||||| |||||||||||| |||||||||    
26037506 caacaacaaccaaaccttatcccactaagtggggtcggctacatggatccaattacgccatagtgttctatcataaaccatattt 26037590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 28236467 - 28236379
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||||||||||||||||||| ||||| | ||||| ||| ||||||  |||| || |||||||||| |||| ||||    
28236467 acaacaacaacaaccaagtcttatcccactaagtggggtcggctacatagatcaaattacaccataatattctatcataaaccaaattt 28236379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 34208266 - 34208354
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||| ||||  |||||  |||||||||| |||||  ||||| ||||||||||||| |||||||||    
34208266 acaacaacaacaaccaagccttatcccaataaggggggtcgagtacatggatcaaattgcgccataatgttctatcataaaccatattt 34208354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 216
Target Start/End: Complemental strand, 37488378 - 37488286
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    |||||||||||||||| ||| ||||||||||||||| |||   | ||||||||| |||||| ||||| ||| ||||||||  |||||||||||    
37488378 caacaacaacaacaaccaagccttatcccactaagtggggctggctacatggatcaaattacgccataatgctctatcattaaccatattttg 37488286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 39100533 - 39100621
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| | |||| ||||| ||||||||| ||| || ||||||    
39100533 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggattatattacgccataatgttctatgataaacaatattt 39100621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 204
Target Start/End: Original strand, 45209200 - 45209280
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| ||| || ||||| || ||||||||||    
45209200 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaactacgccataatattctatcata 45209280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 125 - 192
Target Start/End: Original strand, 50238610 - 50238677
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | ||||||    
50238610 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccata 50238677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 125 - 192
Target Start/End: Original strand, 50238696 - 50238763
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | ||||||    
50238696 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccata 50238763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 1777016 - 1777102
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||| ||| ||||||||| ||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
1777016 aacaacaacaaccaagccttatcccattaagtggggtcggctacatggatcaaatgacgccatactgttctatcatacaccaaattt 1777102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 4441140 - 4441050
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||| || || ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
4441140 caacaacaacgacgacgaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 4441050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 8286726 - 8286636
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||| | | ||||||||| |||| | | |||| |||||||||||| |||| ||||    
8286726 caacaacaacaacaaccaagccttatcccactaagtgggggcggctacatggatcaaatgacgtcatagtgttctatcataaaccaaattt 8286636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 20601651 - 20601737
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| ||| |||||||||||||||| || |||| |||||| || |||||| | ||| ||||||||||||| | |||||||    
20601651 aacaacaacaattaactcttatcccactaagtgggttcagttacatgaatcaaattacgtcataatgttctatcataaatcatattt 20601737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 21237145 - 21237055
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||  ||||||||||||||| ||||  | |||||| || |||| | |||||| ||||||||||||||||| ||||    
21237145 caacaacaacaacaaccaatccttatcccactaagtggggttggctacatgtatcaaatgacgccatagtgttctatcatataccaaattt 21237055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 183
Target Start/End: Complemental strand, 21528575 - 21528517
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| ||||    
21528575 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaat 21528517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 39708708 - 39708630
Alignment:
137 caactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||| ||||||||||||||||||| |||||   ||||||||| |||||| | |||| |||||||||||| |||||||||    
39708708 caaccaagtcttatcccactaagtggggtcgactacatggatcaaattacgacatagtgttctatcataaaccatattt 39708630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 53518319 - 53518408
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||| ||||||||||  |||| ||||||||||||| ||||| | | ||||||| |||||| |||||| |||||||||||| |||||||||    
53518319 caacagcaacaacaaccgagtcctatcccactaagtggggtc-gctgcatggatcaaattacgccatagtgttctatcataaaccatattt 53518408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 56375573 - 56375487
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||| |||||||||||||||||||  |||| | ||||||||| |||| | | |||| |||||||||||| |||| ||||    
56375573 aacaacaacaaccaagtcttatcccactaagtgaggtcggctacatggatcaaatgacgtcatagtgttctatcatacaccaaattt 56375487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 5306582 - 5306493
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||||| ||| |||||||||| |||| |||| || || |||||| |||||| ||||| ||||| | ||||| |||||||||    
5306582 aacaacaacaacaaccaagccttatcccaccaagtggggttagctatatggatcaaattacgccataatgttatgtcataaaccatattt 5306493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 46153995 - 46153942
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | |||||||||    
46153995 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggat 46153942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 131 - 214
Target Start/End: Complemental strand, 4548303 - 4548219
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||| |||  |||||||||||||||||||  | ||||||||| |||||| ||| || |||||||||||| |||| ||||    
4548303 caacaacaaccaagcattatcccactaagttgggttggctacatggatcaaattacgccttagtgttctatcataaaccaaattt 4548219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 204
Target Start/End: Complemental strand, 6957885 - 6957805
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcata 204  Q
    |||||||||||||||| ||| ||||||||||||||| || || | ||||||||| |||| | | |||| ||||||||||||    
6957885 caacaacaacaacaaccaagccttatcccactaagtgggatcggctacatggatcaaatgacgtcatagtgttctatcata 6957805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 19969466 - 19969378
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||||  || ||||||||||||||| ||||| | ||||||||| |||| | ||||||  ||||||||||| |||| ||||    
19969466 acaacaacaacaaccgagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagcgttctatcataaaccaaattt 19969378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 20654923 - 20654875
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatg 175  Q
    ||||||||||||||||||||||||| |||||||| ||||| | ||||||    
20654923 acaacaacaacaactaagtcttatctcactaagtggggtcggatacatg 20654875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 31459280 - 31459228
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    |||||| |||||||| ||| ||||||||||||||| ||||| |||||||||||    
31459280 aacaacgacaacaaccaagccttatcccactaagtggggtcgggtacatggat 31459228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 216
Target Start/End: Complemental strand, 32479321 - 32479233
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttg 216  Q
    |||||||||||| ||| ||| | ||||||||| ||||| | ||||||||| |||| | |||||| |||||||||| | |||||||||||    
32479321 aacaacaacaaccaagcctttttccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcaaaaaccatattttg 32479233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 173
Target Start/End: Original strand, 36556755 - 36556803
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtaca 173  Q
    |||||||||||||||| |||||||||||||| |||| ||||| ||||||    
36556755 caacaacaacaacaaccaagtcttatcccacaaagtggggtcgggtaca 36556803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 192
Target Start/End: Original strand, 46715265 - 46715329
Alignment:
129 aacaacaacaact-aagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    ||||||||||| | ||||||||||||||||||| ||||||| |||||||||  ||||| ||||||    
46715265 aacaacaacaaatcaagtcttatcccactaagtggggtcagttacatggatcgaattatgccata 46715329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 132 - 214
Target Start/End: Complemental strand, 1095725 - 1095642
Alignment:
132 aacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||| ||| |||||||||||||   ||||| ||||||| ||| |||| | ||||| ||||||||||||| |||||||||    
1095725 aacaacaaccaagccttatcccactaaacggggtcgggtacatcgatcaaataacgccataatgttctatcataaaccatattt 1095642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 184
Target Start/End: Original strand, 1211387 - 1211446
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatt 184  Q
    |||||||||||||||| ||||||||||||| ||||| ||||| | |||||| || |||||    
1211387 caacaacaacaacaaccaagtcttatcccattaagtggggtcggctacatgaatcaaatt 1211446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 215
Target Start/End: Complemental strand, 2589359 - 2589268
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatatttt 215  Q
    |||||||||||||||| ||| ||||||||||||| | |||| || |||||| || |||  | |||||| |||||||||| | ||||||||||    
2589359 caacaacaacaacaaccaagccttatcccactaactggggttagctacatgaatcaaacgacgccatagtgttctatcaaaaaccatatttt 2589268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 192
Target Start/End: Original strand, 15661867 - 15661934
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    ||||||| |||||||| ||  ||||||||||||||| ||||| | ||||||||| |||||| ||||||    
15661867 caacaacgacaacaaccaaaccttatcccactaagtggggtcggctacatggatcaaattacgccata 15661934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 192
Target Start/End: Original strand, 26275011 - 26275078
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||||||||||| ||| ||| ||| ||||| | ||||| | ||||||||| |||||||||||||    
26275011 caacaacaacaacaaccaagccttttccaactaaatggggtcggatacatggatcaaattaggccata 26275078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 129 - 168
Target Start/End: Original strand, 30662042 - 30662081
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcag 168  Q
    |||||||||||| ||||||||||||||||||| |||||||    
30662042 aacaacaacaaccaagtcttatcccactaagtagggtcag 30662081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 126 - 165
Target Start/End: Original strand, 51051451 - 51051490
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggt 165  Q
    ||||||||||||||| ||||||||||||||||||| ||||    
51051451 aacaacaacaacaaccaagtcttatcccactaagtggggt 51051490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 127 - 178
Target Start/End: Complemental strand, 56130455 - 56130404
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | |||||||||    
56130455 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggat 56130404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 175
Target Start/End: Original strand, 7066494 - 7066544
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatg 175  Q
    |||||||||||||||| ||| ||||||||||||| | ||||||| ||||||    
7066494 caacaacaacaacaaccaagccttatcccactaaatggggtcagctacatg 7066544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 130 - 223
Target Start/End: Original strand, 36799657 - 36799751
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttgcttcaac 223  Q
    |||||||||| ||||  |||||||||||||| |||||   ||||||||| |||||| || ||| ||||| |||||| ||||||| ||| ||||||    
36799657 acaacaacaattaagctttatcccactaagtggggtcgtctacatggatcaaattatgcgatattgttcaatcataaaccatatattggttcaac 36799751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 129 - 202
Target Start/End: Original strand, 49939733 - 49939807
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatca 202  Q
    ||||||||||||  || ||||||||||||||| ||||| | ||||||||| |||| | |||||| ||||||||||    
49939733 aacaacaacaaccgagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatca 49939807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 128 - 185
Target Start/End: Original strand, 25427860 - 25427917
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    ||||||||||||| |||||||||| || ||||| ||||| | ||||||||| ||||||    
25427860 caacaacaacaaccaagtcttatctcattaagtggggtcggttacatggatcaaatta 25427917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 202
Target Start/End: Original strand, 27450180 - 27450253
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatca 202  Q
    |||||| |||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| ||||||||||    
27450180 acaacagcaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatca 27450253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 29209175 - 29209260
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||| |||||| ||||||||||||| ||||| ||||| | ||||| ||| |||  | ||||| ||| |||||||||||||||||||    
29209175 acaaaaacaaccaagtcttatcccattaagtggggtcggctacattgatcaaacaacgccataatgctctatcatataccatattt 29209260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 168
Target Start/End: Original strand, 50869877 - 50869918
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcag 168  Q
    |||||||||||||| ||| ||||||||||||||| |||||||    
50869877 acaacaacaacaaccaagccttatcccactaagtggggtcag 50869918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 1328609 - 1328669
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||||||||||||| ||| |||||||||||| || || || | ||||||||| ||||||    
1328609 caacaacaacaacaaccaagccttatcccactaggtaggatcggatacatggatcaaatta 1328669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 126 - 166
Target Start/End: Complemental strand, 8327187 - 8327147
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtc 166  Q
    ||||||||||||||| ||| ||||||||||||||| |||||    
8327187 aacaacaacaacaaccaagccttatcccactaagtggggtc 8327147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 129 - 212
Target Start/End: Original strand, 22420716 - 22420800
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatat 212  Q
    |||||||||||| ||| ||||||||||||||| ||||||  ||||| ||| |||  | ||||| ||| |||||||| ||||||||    
22420716 aacaacaacaaccaagccttatcccactaagtggggtcaactacatagatcaaacaacgccataatgctctatcatttaccatat 22420800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 125 - 157
Target Start/End: Original strand, 25959222 - 25959254
Alignment:
125 caacaacaacaacaactaagtcttatcccacta 157  Q
    |||||||||||||||| ||||||||||||||||    
25959222 caacaacaacaacaaccaagtcttatcccacta 25959254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 175
Target Start/End: Original strand, 45184130 - 45184178
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatg 175  Q
    |||| ||||||||||||| ||||||||||||||| ||||| | ||||||    
45184130 acaataacaacaactaagccttatcccactaagtggggtcggctacatg 45184178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 125 - 165
Target Start/End: Original strand, 49454474 - 49454514
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggt 165  Q
    |||||||||||||||| ||| ||||||||||||||| ||||    
49454474 caacaacaacaacaaccaagccttatcccactaagtggggt 49454514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 58; Significance: 3e-24; HSPs: 26)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 34501 - 34590
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||||| ||||||||||||||||||| ||||||| ||||||||| |||||| ||||| ||||||||||||| |||||||||    
34501 aacaacaacaacaaccaagtcttatcccactaagtggggtcagctacatggatcaaattacgccataatgttctatcataaaccatattt 34590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 12890860 - 12890772
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||||| |||||||||||| |||||||||    
12890860 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccatagtgttctatcataaaccatattt 12890772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 34934830 - 34934915
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| |||||||| |||||||||||| |||| ||||    
34934830 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgaggccatagtgttctatcatacaccaaattt 34934915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 3206454 - 3206544
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||| ||| ||||||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||| | | |||||||||    
3206454 caacaacaacaataaccaagtcttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctattaaaaaccatattt 3206544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 28085663 - 28085573
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| |  ||||| |||||||||||| |||| ||||    
28085663 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacaccatagtgttctatcatacaccaaattt 28085573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 133 - 214
Target Start/End: Complemental strand, 30031535 - 30031453
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||| ||| |||||||||||||||  |||| | ||||||||| |||||| |||||| |||||||||||| |||||||||    
30031535 acaacaaccaagccttatcccactaagtgaggtcggctacatggatcaaattacgccatagtgttctatcataaaccatattt 30031453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 9707052 - 9706967
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||| | |||||||||    
9707052 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgatgccatagtgttctatcaaaaaccatattt 9706967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 5096116 - 5096029
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    ||||||||||| ||  ||||||||||||||| || || | ||||| ||| |||||| ||||| ||||||||||||| |||||||||||    
5096116 acaacaacaaccaaaccttatcccactaagtgggatcggctacatagatcaaattacgccataatgttctatcataaaccatattttg 5096029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 34143760 - 34143850
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||| ||||| |||||   ||||||||| |||| | |||||| |||||||||||| |||| ||||    
34143760 caacaacaacaacaaccaagccttatcccaataagtggggtcgactacatggatcaaatgacgccatagtgttctatcatacaccaaattt 34143850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 34156376 - 34156466
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||| ||||| |||||   ||||||||| |||| | |||||| |||||||||||| |||| ||||    
34156376 caacaacaacaacaaccaagccttatcccaataagtggggtcgactacatggatcaaatgacgccatagtgttctatcatacaccaaattt 34156466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 128 - 216
Target Start/End: Complemental strand, 5897741 - 5897652
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    ||||||||||||  ||| ||||||||||||||| || || | ||||||||| |||||| | ||| || ||||| ||||||||||||||||    
5897741 caacaacaacaatcaagccttatcccactaagtgggatccgctacatggatcaaattacgtcataatattctaccatataccatattttg 5897652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 32756207 - 32756118
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||| | |||||||| |||||||||| || || | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
32756207 aacaacaacaacatccaagtcttaccccactaagtgggatcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 32756118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 131 - 183
Target Start/End: Complemental strand, 608442 - 608390
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||| ||||||||||||||||||| ||||| | ||||||||| ||||    
608442 caacaacaaccaagtcttatcccactaagtagggtcggctacatggatcaaat 608390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 31819116 - 31819028
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||| ||||| |||  |||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
31819116 acaacaaccacaaccaagcattatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 31819028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 215
Target Start/End: Original strand, 4245867 - 4245958
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatatttt 215  Q
    ||||||||| |||||| ||| ||||||||||||||| ||||| | ||| ||||| |||  | | ||| ||||||||||| ||||||||||||    
4245867 caacaacaaaaacaaccaagccttatcccactaagtggggtcggctacttggatcaaacgatgtcataatgttctatcaaataccatatttt 4245958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 192
Target Start/End: Original strand, 5258143 - 5258210
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||| ||||| |||| | ||||||    
5258143 caacaacaacaacaaccaagacttatcccactaagtggggtcggctacgtggatcaaatgacgccata 5258210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 130 - 185
Target Start/End: Complemental strand, 33730247 - 33730192
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| ||||||    
33730247 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatgaaatta 33730192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 8364839 - 8364757
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccat 210  Q
    |||||||||||  ||| ||| ||||||||||  ||||| | ||||||||| |||||| ||||| ||||||||||||| |||||    
8364839 aacaacaacaataaagccttttcccactaagcggggtcggctacatggatcaaattacgccataatgttctatcataaaccat 8364757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 9593709 - 9593792
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatatt 213  Q
    |||||||||||| ||| ||||| |||||||||  |||||| || |||||| ||||||  |||| ||||||||||||| ||||||||    
9593709 aacaacaacaaccaagccttatgccactaagtgtggtcagctatatggatcaaatta--ccataatgttctatcataaaccatatt 9593792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 183
Target Start/End: Original strand, 10098891 - 10098949
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||||||||  ||||||||||||||||||| |||||   ||||||||| ||||    
10098891 caacaacaacaacaatcaagtcttatcccactaagtggggtcgattacatggatcaaat 10098949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 131 - 160
Target Start/End: Complemental strand, 6800671 - 6800642
Alignment:
131 caacaacaactaagtcttatcccactaagt 160  Q
    ||||||||||||||||||||||||||||||    
6800671 caacaacaactaagtcttatcccactaagt 6800642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 160
Target Start/End: Original strand, 10422703 - 10422736
Alignment:
127 acaacaacaacaactaagtcttatcccactaagt 160  Q
    |||||||||||||| |||||||||||||||||||    
10422703 acaacaacaacaaccaagtcttatcccactaagt 10422736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 133 - 205
Target Start/End: Complemental strand, 21089676 - 21089603
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatat 205  Q
    |||||||| ||| ||||||||||||||| ||| ||| ||||||||| |||  | ||||| ||||||||||||||    
21089676 acaacaaccaagccttatcccactaagtgggggcagctacatggatcaaacaatgccataatgttctatcatat 21089603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 132 - 168
Target Start/End: Original strand, 4949788 - 4949824
Alignment:
132 aacaacaactaagtcttatcccactaagttgggtcag 168  Q
    ||||||||||||| ||||||||||||||| |||||||    
4949788 aacaacaactaagccttatcccactaagtggggtcag 4949824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 132 - 168
Target Start/End: Original strand, 4956759 - 4956795
Alignment:
132 aacaacaactaagtcttatcccactaagttgggtcag 168  Q
    ||||||||||||| ||||||||||||||| |||||||    
4956759 aacaacaactaagccttatcccactaagtggggtcag 4956795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 130 - 178
Target Start/End: Original strand, 6906827 - 6906875
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    ||||||||| | |||||||||| |||||||||||||| | |||||||||    
6906827 acaacaacatcaaagtcttatcgcactaagttgggtcggctacatggat 6906875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 74)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 28090689 - 28090779
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||||||||||||||||||| ||||| | ||||||||| |||||| ||||| ||||||||||||| |||||||||    
28090689 caacaacaacaacaaccaagtcttatcccactaagtggggtcggctacatggatcaaattacgccataatgttctatcataaaccatattt 28090779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 8796492 - 8796406
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| ||||| ||||||||||||| |||||||||    
8796492 aacaacaacaaccaagccttatcccactaagtggggtcggctacatggattaaattacgccataatgttctatcataaaccatattt 8796406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 25979226 - 25979316
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||||||||    
25979226 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcataaaccatattt 25979316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 126 - 205
Target Start/End: Complemental strand, 1704913 - 1704833
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatat 205  Q
    ||||||||||||||| |||||||||| |||||||| |||||||  |||||||| |||||| ||||| ||||||||||||||    
1704913 aacaacaacaacaaccaagtcttatcacactaagtggggtcagcaacatggatcaaattatgccatgatgttctatcatat 1704833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 124 - 203
Target Start/End: Original strand, 7133296 - 7133376
Alignment:
124 gcaacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggcc-atatgttctatcat 203  Q
    ||||||||||||||||| ||| ||| ||||||||||| ||||||| ||||||||| |||||||||| | ||||||||||||    
7133296 gcaacaacaacaacaaccaagccttttcccactaagtggggtcagctacatggatcaaattaggccaaaatgttctatcat 7133376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 38807668 - 38807756
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||  |||||| |||||| |||||||||||| |||||||||    
38807668 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggaacaaattacgccatagtgttctatcataaaccatattt 38807756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 41560514 - 41560426
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| ||||| |||||||||||||  ||||||||    
41560514 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccataatgttctatcataacccatattt 41560426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 44941774 - 44941861
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||||| |||||||||||| |||| ||||    
44941774 caacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccatagtgttctatcataaaccaaattt 44941861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 30202125 - 30202215
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
30202125 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 30202215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 1211030 - 1210942
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
1211030 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 1210942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 125 - 216
Target Start/End: Complemental strand, 6084262 - 6084170
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttg 216  Q
    ||||||||| |||||| ||| |||||||||||||||  | |||  ||||||||| |||||| |||||| |||||||||||| |||||||||||    
6084262 caacaacaataacaaccaagccttatcccactaagtgagatcaaatacatggatcaaattacgccatattgttctatcataaaccatattttg 6084170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 125 - 192
Target Start/End: Complemental strand, 26299355 - 26299288
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    ||||||||||| |||| ||||||||||||||||||| ||||| | ||||||||| |||||| ||||||    
26299355 caacaacaacagcaaccaagtcttatcccactaagtggggtcggctacatggatcaaattacgccata 26299288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 132 - 214
Target Start/End: Original strand, 37462878 - 37462961
Alignment:
132 aacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| ||||| ||||||||| ||| |||||||||    
37462878 aacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccataatgttctatgataaaccatattt 37462961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 130 - 216
Target Start/End: Original strand, 40568410 - 40568497
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttg 216  Q
    ||||||||||| ||| ||||||||||||||| ||||  | ||||||||| |||||| |||||| | |||||||||| |||||||||||    
40568410 acaacaacaaccaagccttatcccactaagtggggttggctacatggatcaaattacgccatagttttctatcataaaccatattttg 40568497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 183
Target Start/End: Complemental strand, 4029409 - 4029351
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||||||||| ||||||||||||||||||| ||||| | ||||||||| ||||    
4029409 caacaacaacaacaaccaagtcttatcccactaagtggggtcggctacatggatcaaat 4029351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 130 - 223
Target Start/End: Original strand, 25715326 - 25715420
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttgcttcaac 223  Q
    ||||||||||| ||| |||||||||||||||  |||| | ||||||||| |||||| ||||| || |||||||||| ||||||||| | ||||||    
25715326 acaacaacaaccaagccttatcccactaagtgaggtcggctacatggatcaaattacgccataatattctatcataaaccatatttcggttcaac 25715420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 128 - 209
Target Start/End: Complemental strand, 29577536 - 29577454
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatatacca 209  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| ||||    
29577536 caacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacacca 29577454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 51602343 - 51602253
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||  | ||||||||| |||| | ||||| ||||||||||||| |||| ||||    
51602343 caacaacaacaacaaccaagccttatcccactaagtggggttggctacatggatcaaatgacgccatgatgttctatcatacaccaaattt 51602253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 21769711 - 21769796
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| ||| |||||| |||||||| ||||| | ||||||||| |||||| ||||| ||||||||||| | |||||||||    
21769711 acaacaacaaccaagccttatcacactaagtggggtcggctacatggatcaaattacgccataatgttctatcacaaaccatattt 21769796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 39318414 - 39318326
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||||  ||| ||||||||||||||  ||||| | ||||||||| |||||| |||||| |||||||||||| |||||||||    
39318414 aacaacaacaacaaacaagccttatcccactaag-cgggtcggctacatggatcaaattacgccatagtgttctatcataaaccatattt 39318326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 49347393 - 49347478
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
49347393 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 49347478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 128 - 216
Target Start/End: Original strand, 52532614 - 52532703
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    |||| |||||||| ||| ||| ||||||||||| ||||| | |||||| || |||||| ||||| ||||||||||||| |||||||||||    
52532614 caaccacaacaaccaagccttttcccactaagtggggtcggctacatgaatcaaattacgccataatgttctatcataaaccatattttg 52532703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 52921362 - 52921277
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | || ||| |||||||||||| |||||||||    
52921362 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgcaatagtgttctatcataaaccatattt 52921277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 4707218 - 4707305
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||| ||| |||||| |||||| |||||||||||| |||| ||||    
4707218 acaacaacaacaaccaagccttatcccactaagtggggtcggctacat-gatcaaattacgccatagtgttctatcataaaccaaattt 4707305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 37311752 - 37311840
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||| ||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||| | |||||||||    
37311752 acaacaacaacaaccaagccttttcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcaaaaaccatattt 37311840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 43481793 - 43481853
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| ||||||    
43481793 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatta 43481853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 44751769 - 44751681
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| |||||||||||||||  |||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
44751769 acaacaacaacaaccaagccttatcccactaagtgaggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 44751681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 48431396 - 48431484
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||| ||||||| ||||||| |||| |||| |||||| ||||| ||||| ||||| | |||||||||    
48431396 acaacaacaacaaccaagccttatcctactaagtggggtcagctacaaggatcaaattaagccatgatgttttatcacaaaccatattt 48431484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 132 - 214
Target Start/End: Original strand, 1290033 - 1290116
Alignment:
132 aacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||| ||||||| ||| ||| ||||| |  |||||||| |||||| ||||| ||||||||||||| |||||||||    
1290033 aacaacaactaagccttatccaactgagtggggtcggccacatggatcaaattatgccataatgttctatcataaaccatattt 1290116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 130 - 204
Target Start/End: Complemental strand, 28533749 - 28533674
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcata 204  Q
    ||||||||||| ||||||||||||||||||| ||||| | ||||||||| |||| | | |||| ||||||||||||    
28533749 acaacaacaaccaagtcttatcccactaagtggggtcggctacatggatcaaatgacgtcatagtgttctatcata 28533674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 34792347 - 34792434
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||| ||| ||||||||| ||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
34792347 caacaacaacaaccaagccttatcccattaagtggggtcggctacatggatcaaatgacgccatagtgttctatcataaaccaaattt 34792434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 50257852 - 50257765
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    ||||||||||| ||| |||||| |||||||| ||||  | ||||||||| ||||||  |||| ||||||||||||| |||||||||||    
50257852 acaacaacaacgaagccttatctcactaagtggggttggctacatggatcaaattacaccataatgttctatcataaaccatattttg 50257765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 130 - 223
Target Start/End: Complemental strand, 2544875 - 2544781
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttgcttcaac 223  Q
    ||||||||||| ||| ||| | ||||||||| ||||| | ||||||||| |||||| ||||| ||||||||| ||| ||||||||| ||| ||||    
2544875 acaacaacaaccaagccttttaccactaagtggggtcggctacatggatcaaattatgccataatgttctattataaaccatatttcgctccaac 2544781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 167
Target Start/End: Complemental strand, 7922112 - 7922070
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtca 167  Q
    |||||||||||||||| ||||||||||||||||||| ||||||    
7922112 caacaacaacaacaaccaagtcttatcccactaagtggggtca 7922070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 22175432 - 22175342
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||| ||||| |||| ||| ||||||||||||||| ||||| | ||||||||| |||||   |||| ||||||||||||| |||||||||    
22175432 caacatcaacaccaaccaagccttatcccactaagtggggtcggctacatggatcaaattctaccataatgttctatcataaaccatattt 22175342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 126 - 216
Target Start/End: Original strand, 28511793 - 28511888
Alignment:
126 aacaacaacaacaactaagtct----tatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    ||||||||||||||| ||||||    ||||||||||||| ||||| | ||||| ||| |||||| ||||| ||||||||||||| ||||| |||||    
28511793 aacaacaacaacaaccaagtcttatgtatcccactaagtggggtcggctacattgatcaaattacgccataatgttctatcataaaccatgttttg 28511888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 31274396 - 31274486
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| |||  |||||||||||||| ||||||| ||||  ||| |||||| ||||| | ||| ||||||| |||||||||    
31274396 caacaacaacaacaaccaagcattatcccactaagtggggtcagctacacagatcaaattacgccataacgttatatcataaaccatattt 31274486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 34444643 - 34444553
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||| ||| ||||||  |||| ||||| ||| ||| |||||||||    
34444643 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatagatcaaattacaccataatgttttattataaaccatattt 34444553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 51440764 - 51440850
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||| ||||||||||||||||||| ||||| | |||||| || |||| | ||| || |||||||||||| |||| ||||    
51440764 aacaacaacaaccaagtcttatcccactaagtggggtcggttacatgaatcaaatgacgccgtagtgttctatcatacaccaaattt 51440850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 183
Target Start/End: Complemental strand, 4380241 - 4380189
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    ||||||||||| |||||||||||||||||| |||||| | ||||||||||||||    
4380241 acaacaacaaccaagtcttatcccactaag-tgggtcggctacatggataaaat 4380189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 146 - 214
Target Start/End: Original strand, 19908051 - 19908120
Alignment:
146 cttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||||| ||||| | |||||||||||||||| || || |||||| |||||| |||||||||    
19908051 cttatcccactaagtggggtcggctacatggataaaattacgcaataatgttcaatcataaaccatattt 19908120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 26113436 - 26113521
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccata 211  Q
    |||||||||||||   ||||||||||||||||||  | || | ||||||||| |||||| ||||| ||||||||||||| ||||||    
26113436 acaacaacaacaatgtagtcttatcccactaagtgagctcggctacatggatcaaattaagccataatgttctatcataaaccata 26113521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 42337838 - 42337753
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||  | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
42337838 acaacaacaaccaagccttatcccactaagtggggttggctacatggatcaaatgatgccatagtgttctatcatacaccaaattt 42337753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 10200303 - 10200391
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| |||  |||||||| |||||  |||| | ||||||||| ||||||  |||| ||||||||||||| |||||||||    
10200303 acaacaacaacaaccaagcattatcccattaagtgaggtcggctacatggatcaaattacaccatgatgttctatcataaaccatattt 10200391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 11584282 - 11584194
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||  ||||||||||||||||||| | ||| | || |||||| ||||||  |||| ||||| ||||||| |||||||||    
11584282 acaacaacaacaatcaagtcttatcccactaagtggagtcggttagatggatcaaattataccataatgttttatcatagaccatattt 11584194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 19936745 - 19936657
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||  ||||||||||||||||||  | ||| | ||||||||| |||||| ||| | ||||||||||||  |||||||||    
19936745 acaacaacaacaatcaagtcttatcccactaagcggagtcggctacatggatcaaattacgccgtaatgttctatcattaaccatattt 19936657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 22090381 - 22090293
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||| ||| ||||| | ||||||||| |||| | | |||| |||||||||||| |||| ||||    
22090381 acaacaacaacaaccaagccttatcccacttagtggggtcggctacatggatcaaatgacgtcatagtgttctatcatacaccaaattt 22090293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 177
Target Start/End: Original strand, 38758015 - 38758067
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatgga 177  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||    
38758015 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatgga 38758067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 131 - 214
Target Start/End: Original strand, 43240380 - 43240464
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| |||||||||||||||  |||| | |||||| || |||| | |||||| |||||||||||| |||| ||||    
43240380 caacaacaactaagccttatcccactaagtgaggtcggctacatgaatcaaatgacgccatagtgttctatcatacaccaaattt 43240464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 50846846 - 50846750
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttgcttcaac 223  Q
    ||||||||||||| |||  || ||||||||||| | ||| | ||||| ||| |||||| ||||| ||||||||||||| || |||||||| ||||||    
50846846 caacaacaacaaccaagcattttcccactaagtggtgtcggctacatagatcaaattatgccataatgttctatcataaactatattttggttcaac 50846750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 192
Target Start/End: Original strand, 2914118 - 2914185
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||||||||||| ||| ||||||||||||||| ||||  | ||||||||| ||| || ||||||    
2914118 caacaacaacaacaaccaagccttatcccactaagtggggttggctacatggatcaaagtacgccata 2914185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 6025889 - 6025802
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||| |||||| |||| |||||||||||||| |  || | ||||||||| |||| | ||||| ||||||||||| |||||||||||    
6025889 caacaaaaacaaccaagtattatcccactaagtggaatcggctacatggatcaaatgacgccatcatgttctatcagataccatattt 6025802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 9593018 - 9592931
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||| ||| ||||||||| ||||| ||||| | ||||||||| |||| | || ||| |||||||||||| |||| ||||    
9593018 caacaacaacaaccaagccttatcccattaagtggggtcggctacatggatcaaatgacgctatagtgttctatcatacaccaaattt 9592931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 32404525 - 32404607
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggcca-tatgttctatcatataccat 210  Q
    ||||||||||||| | | ||||||||||||||| ||||| | ||||||||| |||||| |||| |||||| ||||||| |||||    
32404525 caacaacaacaacca-gccttatcccactaagtggggtcggctacatggatcaaattacgccattatgttatatcataaaccat 32404607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 192
Target Start/End: Complemental strand, 41165569 - 41165502
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||||||||||| ||| ||| ||||||||||| ||||| | ||||||||| |||| | ||||||    
41165569 caacaacaacaacaaccaagccttttcccactaagtggggtcggctacatggatcaaatgacgccata 41165502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 183
Target Start/End: Original strand, 4318840 - 4318898
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||||||||| ||| ||| ||||||||||| ||||| | ||||||||| ||||    
4318840 caacaacaacaacaaccaagccttttcccactaagtggggtcggctacatggatcaaat 4318898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 131 - 212
Target Start/End: Original strand, 4590533 - 4590615
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatat 212  Q
    |||||||||| ||  ||||||||||||||| ||||| | ||||||||| ||||||  ||||| |||||||||| ||| |||||    
4590533 caacaacaaccaaaccttatcccactaagtggggtcggctacatggatcaaattacaccatattgttctatcacatatcatat 4590615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 129 - 163
Target Start/End: Original strand, 17640066 - 17640100
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgg 163  Q
    ||||| |||||||||||||||||||||||||||||    
17640066 aacaataacaactaagtcttatcccactaagttgg 17640100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 166
Target Start/End: Original strand, 8809496 - 8809537
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtc 166  Q
    |||||||||||||||| ||| ||||||||||||||| |||||    
8809496 caacaacaacaacaaccaagccttatcccactaagtggggtc 8809537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 177
Target Start/End: Complemental strand, 10674775 - 10674730
Alignment:
132 aacaacaactaagtcttatcccactaagttgggtcaggtacatgga 177  Q
    ||||||||| ||||||||||||||||||| |||| || ||||||||    
10674775 aacaacaacaaagtcttatcccactaagtggggtaagctacatgga 10674730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 15086208 - 15086151
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    ||||||||||||||| ||| ||||||||||||||| ||||  | ||||||||| ||||    
15086208 aacaacaacaacaaccaagccttatcccactaagtggggttggctacatggatcaaat 15086151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 214
Target Start/End: Original strand, 19908400 - 19908469
Alignment:
146 cttatcccactaagttgggtcaggtacatggataaaattaggccatatg-ttctatcatataccatattt 214  Q
    ||||||||||||||| ||||||||||||||||| ||| || || ||| | |||||| ||| |||||||||    
19908400 cttatcccactaagtggggtcaggtacatggatcaaactacgcaataagattctattataaaccatattt 19908469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 175
Target Start/End: Complemental strand, 26016723 - 26016674
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatg 175  Q
    |||||||| ||||||||||||||| |||||||||| || |||| ||||||    
26016723 aacaacaagaacaactaagtcttaccccactaagtgggctcagctacatg 26016674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 27072491 - 27072572
Alignment:
134 caacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||| ||| ||| ||||||||||   |||| | ||||||||| |||||| |||||| |||||||||||| |||||||||    
27072491 caacaaccaagccttttcccactaagcatggtcggctacatggatcaaattacgccataatgttctatcataaaccatattt 27072572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 204
Target Start/End: Complemental strand, 27704238 - 27704157
Alignment:
125 caacaacaacaacaactaagtc-ttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||||||||  ||||| || ||||||||||  ||||| | ||||||||| |||||| ||||| |||||||||||||    
27704238 caacaacaacaacaaacaagtctttttcccactaagcggggtcggctacatggatcaaattacgccataatgttctatcata 27704157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 35828562 - 35828647
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| ||||||| ||||||||||  ||||| | ||||||||| ||||   ||||| |||||||||| || |||||||||    
35828562 acaacaacaaccaagtcttttcccactaagcggggtcggttacatggatcaaatattgccataatgttctatcgtaaaccatattt 35828647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 128 - 212
Target Start/End: Complemental strand, 38869166 - 38869081
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatat 212  Q
    |||||||| |||| |||  || ||||||||||| ||||| | ||||||||| |||  | |||||| ||||||||||||||||||||    
38869166 caacaacagcaaccaagcattttcccactaagtggggtcggctacatggatcaaacgacgccataatgttctatcatataccatat 38869081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 158
Target Start/End: Complemental strand, 42340141 - 42340108
Alignment:
125 caacaacaacaacaactaagtcttatcccactaa 158  Q
    |||||||||||||||| |||||||||||||||||    
42340141 caacaacaacaacaaccaagtcttatcccactaa 42340108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 131 - 184
Target Start/End: Original strand, 52561590 - 52561643
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatt 184  Q
    |||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||    
52561590 caacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatt 52561643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 696554 - 696466
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggcc-ata-tgttctatcatataccatattt 214  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | ||||| ||| |||| | ||| ||| |||||||||| | |||||||||    
696554 caacaacaacaaccaagccttatcccactaagtggggtcggctacattgatcaaatgacgccaatagtgttctatcaaaaaccatattt 696466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 133 - 193
Target Start/End: Original strand, 7210930 - 7210990
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatat 193  Q
    ||||||||  || ||||||||||||||| ||||| | ||||||||| |||||| |||||||    
7210930 acaacaaccgaggcttatcccactaagtggggtcggttacatggatcaaattatgccatat 7210990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 27847797 - 27847885
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||  || ||| |||||||||||||||  | || | |||||||||||||||| | ||| |||||| |||||| |||||||||    
27847797 acaacaacaatgaccaagccttatcccactaagtgagatcggctacatggataaaattacggcataatgttccatcataaaccatattt 27847885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 32082753 - 32082809
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||| ||||||| ||| ||||||||||| ||||| | ||||||||| ||||    
32082753 acaacaacaaaaactaagccttttcccactaagtggggtcggctacatggatcaaat 32082809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 126 - 158
Target Start/End: Complemental strand, 50425341 - 50425309
Alignment:
126 aacaacaacaacaactaagtcttatcccactaa 158  Q
    |||| ||||||||||||||||||||||||||||    
50425341 aacatcaacaacaactaagtcttatcccactaa 50425309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 3e-21; HSPs: 49)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 125 - 216
Target Start/End: Complemental strand, 6859668 - 6859576
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    ||||||||||||| || ||| ||||||||||||||| |||||||  ||||||||||||||| ||||| ||||||||||||| |||||||||||    
6859668 caacaacaacaactaccaagccttatcccactaagtggggtcagcaacatggataaaattatgccataatgttctatcataaaccatattttg 6859576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 18855890 - 18855804
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||| ||||||||||||||||||| ||||| | ||||||||| |||||| || || ||||||||||||| |||||||||    
18855890 aacaacaacaaccaagtcttatcccactaagtggggtcggctacatggatcaaattatgctataatgttctatcataaaccatattt 18855804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 4496671 - 4496581
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
4496671 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgatgccatagtgttctatcatacaccaaattt 4496581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 5558424 - 5558338
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||| ||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||||| |||||||||||| |||||||||    
5558424 aacaacgacaaccaagccttatcccactaagtggggtcggctacatggatcaaattatgccatagtgttctatcataaaccatattt 5558338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 126 - 211
Target Start/End: Complemental strand, 14668057 - 14667971
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccata 211  Q
    ||||||||| ||||| ||||||||||||||||||| ||||| | ||||||||| ||||||  |||| ||||||||||||| ||||||    
14668057 aacaacaactacaaccaagtcttatcccactaagtggggtcggttacatggatcaaattacaccataatgttctatcataaaccata 14667971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 42576295 - 42576217
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggcca-tatgttctatcata 204  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||| ||||||||||||||    
42576295 acaacaacaacaaccaagccttatcccactaagtcgggtcggctacatggatcaaattacgccattatgttctatcata 42576217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 14665999 - 14665911
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||| ||| |||||| |||| | ||||||||||| |||||||||    
14665999 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatagatcaaattacgccaga-gttctatcataaaccatattt 14665911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 16347380 - 16347463
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatataccatattt 214  Q
    ||||||||||| ||||||||||||||||||| ||||| | ||||||||| |||| | ||||  |||||||||||| |||||||||    
16347380 acaacaacaaccaagtcttatcccactaagtagggtcggctacatggatcaaatgacgcca-gtgttctatcataaaccatattt 16347463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 29816667 - 29816579
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
29816667 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 29816579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 11069160 - 11069243
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccat 210  Q
    ||||||||||||| ||| | |||||||||| || ||||||| || |||||| |||||| ||||| |||||||||||||||||||    
11069160 caacaacaacaaccaagccatatcccactatgtggggtcagctatatggatcaaattacgccataatgttctatcatataccat 11069243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 11675814 - 11675727
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||| ||| ||||||| ||||||| ||||| | ||||||||| ||| || ||||| ||||||||||||| |||||||||    
11675814 caacaacaacaaccaagccttatccaactaagtggggtcggctacatggattaaactacgccataatgttctatcataaaccatattt 11675727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 10639589 - 10639499
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| |||||||||| |||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
10639589 caacaacaacaacaaccaagccttatcccacaaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 10639499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 12492379 - 12492469
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | |||||| || |||| | |||||| |||||||||||| |||| ||||    
12492379 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatgcatcaaatgacgccatagtgttctatcatacaccaaattt 12492469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 28976854 - 28976944
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | |||||| || |||| | |||||| |||||||||||| |||| ||||    
28976854 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatgaatcaaatgacgccatagtgttctatcatacaccaaattt 28976944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 30213862 - 30213772
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||| |||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
30213862 caacaacaaaaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 30213772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 128 - 185
Target Start/End: Original strand, 7359259 - 7359316
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    ||||||||||||| ||||||| ||||||||||| ||||||| ||||||||| ||||||    
7359259 caacaacaacaaccaagtcttgtcccactaagtggggtcagctacatggatcaaatta 7359316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 138 - 214
Target Start/End: Complemental strand, 9235320 - 9235244
Alignment:
138 aactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||| ||||||||||||||| ||||| | ||||||||| |||||| |||||| |||||||||||| |||||||||    
9235320 aactaagccttatcccactaagt-gggtcggctacatggatcaaattatgccataatgttctatcataaaccatattt 9235244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 129 - 201
Target Start/End: Complemental strand, 42272760 - 42272687
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatc 201  Q
    ||||||||||||| || ||||||||||||||| ||||||| ||||||||| |||| | ||||| ||||||||||    
42272760 aacaacaacaacttagccttatcccactaagtggggtcagctacatggatcaaatgacgccataatgttctatc 42272687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 204
Target Start/End: Original strand, 2915491 - 2915571
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcata 204  Q
    |||||||||||| ||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| ||||||||||||    
2915491 caacaacaacaataaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcata 2915571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 38132619 - 38132543
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||||| ||| ||||||||||||||| ||||| |  |||||||| |||||| ||||| |||||||||||||    
38132619 aacaacaacaaccaagccttatcccactaagtggggtcggccacatggatcaaattacgccataatgttctatcata 38132543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 41894360 - 41894300
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||||||||||||| ||||||||||||||||||| ||||  | ||||||||| ||||||    
41894360 caacaacaacaacaacaaagtcttatcccactaagtggggttggctacatggatcaaatta 41894300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 38685242 - 38685164
Alignment:
137 caactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||||||||    
38685242 caaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatattgttctatcataaaccatattt 38685164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 223
Target Start/End: Complemental strand, 1275549 - 1275452
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttgcttcaac 223  Q
    |||||||||||||||| | ||||||||||||||| ||||| | ||||||||| |||| | | ||| ||||||||||| | |||| |||| | ||||||    
1275549 acaacaacaacaactatgccttatcccactaagtggggtcggctacatggatcaaatgacgtcataatgttctatcaaacaccaaatttggattcaac 1275452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 3302126 - 3302041
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | ||| || |||||||||| | |||||||||    
3302126 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccgtagtgttctatcaaaaaccatattt 3302041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 192
Target Start/End: Original strand, 408492 - 408556
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | ||||||    
408492 caacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccata 408556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 216
Target Start/End: Original strand, 683696 - 683788
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    |||||||||||| ||| |||||||||||| |||||| ||||  | ||||||||| ||| ||   ||| ||||||||||||| |||||||||||    
683696 caacaacaacaaaaacaaagtcttatcccgctaagtggggttggctacatggatcaaactacaacataatgttctatcataaaccatattttg 683788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 4653539 - 4653479
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||||||||||||| |||||||||| |||||||| ||||| | |||||| || ||||||    
4653539 caacaacaacaacaaccaagtcttatctcactaagtggggtcggatacatgaatcaaatta 4653479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 211
Target Start/End: Original strand, 13561384 - 13561468
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccata 211  Q
    ||||||||||||  ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||| | ||||||    
13561384 caacaacaacaaacaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcaaaaaccata 13561468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 129 - 192
Target Start/End: Complemental strand, 2090696 - 2090633
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||||||| ||| ||||||||||| | | ||||| ||||||||||| |||||| ||||||    
2090696 aacaacaacaacaaagccttatcccactcaatggggtcgggtacatggatcaaattacgccata 2090633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 5860118 - 5860035
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccat 210  Q
    ||||||||||||  ||| ||||||||||||||| ||||| | ||||| ||| |||||| ||||| ||| ||||||||| |||||    
5860118 caacaacaacaatcaagccttatcccactaagtagggtcggctacatagatcaaattacgccataatggtctatcataaaccat 5860035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 168
Target Start/End: Complemental strand, 29929341 - 29929298
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcag 168  Q
    |||||||||||||||| ||| ||||||||||||||| |||||||    
29929341 caacaacaacaacaaccaagccttatcccactaagtggggtcag 29929298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 131 - 204
Target Start/End: Complemental strand, 20457054 - 20456980
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||  ||| ||||||||||||||| ||||| | ||||||||| |||| | ||||| |||||||||||||    
20457054 caacaacaatcaagccttatcccactaagtggggtcggctacatggatcaaatgacgccataatgttctatcata 20456980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 130 - 192
Target Start/End: Complemental strand, 27386622 - 27386560
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    ||||||||||| | | ||||||||||||||| ||||| | ||||||||| |||||| ||||||    
27386622 acaacaacaaccatgccttatcccactaagtggggtcggctacatggatcaaattacgccata 27386560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 32442121 - 32442210
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||| ||| ||| ||||||||||||||| | ||| | ||||||||| |||||| ||||| ||||||||||  | |||||||||    
32442121 caacaacaacaataaccaag-cttatcccactaagtggagtcggctacatggatcaaattacgccataatgttctatccaaaaccatattt 32442210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 35118321 - 35118407
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgtt-ctatcatataccatattt 214  Q
    |||||||||||  ||| ||||||||||||| |  |||| ||||||||||| |||||| || | ||||| |||||||| |||||||||    
35118321 aacaacaacaatcaagccttatcccactaaatgaggtcgggtacatggatcaaattacgctaaatgttcctatcataaaccatattt 35118407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 79799 - 79710
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||| || ||| ||| ||||||||||| ||| ||| ||||||||| |||| | ||||| ||| ||||||||  |||||||||    
79799 aacaacaacaaccaccaagccttttcccactaagtggggccagctacatggatgaaatcacgccataatggtctatcatgcaccatattt 79710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 129 - 178
Target Start/End: Complemental strand, 7678760 - 7678711
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    |||||||||||| |||| |||||||||||||| ||||| | |||||||||    
7678760 aacaacaacaaccaagttttatcccactaagtggggtcggctacatggat 7678711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 201
Target Start/End: Complemental strand, 29922571 - 29922494
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatc 201  Q
    |||||||||||||||| ||| |||||||||| ||||  |||  | ||||||||| |||||| ||||| ||||||||||    
29922571 caacaacaacaacaaccaaggcttatcccaccaagtgaggttggctacatggatcaaattacgccataatgttctatc 29922494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 35720626 - 35720659
Alignment:
128 caacaacaacaactaagtcttatcccactaagtt 161  Q
    ||||||||||||| ||||||||||||||||||||    
35720626 caacaacaacaaccaagtcttatcccactaagtt 35720659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 160
Target Start/End: Original strand, 36123179 - 36123212
Alignment:
127 acaacaacaacaactaagtcttatcccactaagt 160  Q
    |||||||||||||| |||||||||||||||||||    
36123179 acaacaacaacaaccaagtcttatcccactaagt 36123212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 43557833 - 43557918
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| | | ||||||||||||||| ||||| | ||||| ||| || ||| | ||| ||||||||||||| |||||||||    
43557833 acaacaacaaccaggccttatcccactaagtggggtcggctacatagatcaacttaagtcataatgttctatcataaaccatattt 43557918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 418031 - 418119
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||   ||| | |||||||| |||| ||||| | ||||||||| |||||| ||||| ||||||||||||| |||| ||||    
418031 acaacaacaacattcaagccatatcccaccaagtggggtcggctacatggatcaaattacgccataatgttctatcataaaccacattt 418119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 6889240 - 6889188
Alignment:
165 tcaggtacatggataaaattaggccata-tgttctatcatataccatattttg 216  Q
    |||| ||||||||| |||||| |||||| |||||||||||| |||||||||||    
6889240 tcagctacatggattaaattacgccataatgttctatcataaaccatattttg 6889188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 133 - 216
Target Start/End: Original strand, 7640510 - 7640594
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttg 216  Q
    ||||||||  || ||||| ||||||||| || || | ||||||||| |||||| ||| || |||||||||||| |||||||||||    
7640510 acaacaaccgagccttattccactaagtgggatcggctacatggatcaaattacgccgtagtgttctatcataaaccatattttg 7640594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 131 - 214
Target Start/End: Original strand, 12576861 - 12576945
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||| |||  |||||||||||| | ||||| | |||||| ||||||| |  |||| ||| |||||||||||||||||||    
12576861 caacaacaaccaagctttatcccactaattggggtcggctacatgtataaaatgacaccataatggtctatcatataccatattt 12576945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 125 - 216
Target Start/End: Original strand, 26884684 - 26884776
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttg 216  Q
    |||||||||||||||  ||| ||||| ||||||||| ||||| | ||||||||| |||||  | | || |||||||||||| | |||||||||    
26884684 caacaacaacaacaatcaagccttattccactaagtggggtcggctacatggatcaaattgcgtcgtagtgttctatcataaatcatattttg 26884776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 28411961 - 28411913
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatg 175  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||    
28411961 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatg 28411913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 36551429 - 36551373
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||||||||| ||| |||||| |||||||| ||||| | ||||||||| ||||||    
36551429 aacaacaacaaccaagccttatctcactaagtggggtcggctacatggatcaaatta 36551373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 38830604 - 38830517
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||  ||| ||||||||||| ||||||| |||||||||  ||||| || || ||||||||||||| | |||||||    
38830604 acaacaacaacaaccaaaccttttcccactaagtggggtcagctacatggat-caattacgctataatgttctatcatacatcatattt 38830517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 1e-20; HSPs: 53)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 130 - 216
Target Start/End: Original strand, 35914601 - 35914688
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    ||||||||||| |||||||||| |||||||| ||||||| ||||||||| |||||| ||||| ||||||||||||| |||||||||||    
35914601 acaacaacaaccaagtcttatctcactaagtggggtcagctacatggatcaaattacgccataatgttctatcataaaccatattttg 35914688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 490622 - 490532
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||  ||| ||||||||||||||| ||||| | ||||||||| |||||| ||||| ||||||||||||| |||||||||    
490622 caacaacaacaacaaacaagccttatcccactaagtggggtcggctacatggatcaaattacgccataatgttctatcataaaccatattt 490532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 124 - 214
Target Start/End: Original strand, 42469721 - 42469812
Alignment:
124 gcaacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||||||| ||| ||||||||| ||||| ||||||| ||||||||| |||| | |||||| |||||||||| | |||||||||    
42469721 gcaacaacaacaacaaccaagccttatcccaataagtggggtcagctacatggatcaaatgacgccatagtgttctatcaaaaaccatattt 42469812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 32931247 - 32931157
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||| ||||||| ||| ||| ||||||||||| ||||| | ||||||||| |||||| ||||| ||||||||||||| |||||||||    
32931247 caacaacatcaacaaccaaggcttttcccactaagtggggtcggctacatggatcaaattatgccataatgttctatcatacaccatattt 32931157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 44047527 - 44047617
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||||| ||||||||| |||| | |||||  |||||||||||| |||| ||||    
44047527 caacaacaacaacaaccaagccttatcccactaagtggggtcagctacatggatcaaatgacgccatggtgttctatcataaaccaaattt 44047617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 11523720 - 11523808
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
11523720 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 11523808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 128 - 201
Target Start/End: Original strand, 1928585 - 1928659
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatc 201  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| ||||| ||||||||||    
1928585 caacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccataatgttctatc 1928659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 133 - 214
Target Start/End: Original strand, 12491141 - 12491223
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
12491141 acaacaactaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 12491223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 202
Target Start/End: Original strand, 14742077 - 14742155
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatca 202  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| ||||||||||    
14742077 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatca 14742155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 125 - 213
Target Start/End: Complemental strand, 21121432 - 21121344
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatatt 213  Q
    |||||||||||||||| ||| ||| ||||||||||| ||||| | ||||| ||| |||||| |||||| |||||||||||| ||||||||    
21121432 caacaacaacaacaaccaagccttttcccactaagtggggtcggctacat-gatcaaattacgccatagtgttctatcataaaccatatt 21121344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 44529507 - 44529422
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
44529507 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgatgccatagtgttctatcataaaccaaattt 44529422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 45041315 - 45041400
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatatt 213  Q
    |||| ||||||| ||| ||||||||||||||| ||||||| ||||||||| |||||| ||||| |||  |||||||| ||||||||    
45041315 aacatcaacaaccaagccttatcccactaagtggggtcagctacatggatcaaattacgccataatgcgctatcataaaccatatt 45041400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 45419517 - 45419432
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| ||||||  |||| ||||||||||||| |||| ||||    
45419517 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacaccataatgttctatcataaaccaaattt 45419432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 133 - 204
Target Start/End: Complemental strand, 1313843 - 1313771
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||| |||  |||||||||||||| ||||||  |||||||||||||||| ||||| |||||||||||||    
1313843 acaacaaccaagcattatcccactaagtggggtcaactacatggataaaattacgccataatgttctatcata 1313771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 204
Target Start/End: Original strand, 27556297 - 27556377
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||||||||| |||  ||| |||||||||| ||||| | ||||||||| |||||| ||||| |||||||||||||    
27556297 caacaacaacaacaaccaagctttaacccactaagtggggtcggctacatggatcaaattatgccataatgttctatcata 27556377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 36545434 - 36545346
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | | |||| |||||||||||| |||| ||||    
36545434 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgtcatagtgttctatcatacaccaaattt 36545346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 126 - 216
Target Start/End: Complemental strand, 14903847 - 14903756
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    ||||||||||||||| |||| ||  |||||||||| |||| || ||||||||| |||||| ||||| |||| |||||||| ||| |||||||    
14903847 aacaacaacaacaaccaagtttttccccactaagtggggtaagctacatggatcaaattacgccataatgtcctatcataaaccttattttg 14903756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 36565239 - 36565326
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||  || ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
36565239 caacaacaacaaccgagccttatcccactaagtggggtcggctacatggatcaaataacgccatagtgttctatcatacaccaaattt 36565326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 25473402 - 25473488
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | || ||| |||||||||||| |||| ||||    
25473402 aacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgctatagtgttctatcatacaccaaattt 25473488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 29520931 - 29520846
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| |||  |||||||||||| | ||||  | ||||||||| |||||| ||||| ||||||||||||| |||||||||    
29520931 acaacaacaaccaagcattatcccactaaatggggtgggctacatggatcaaattacgccataatgttctatcataaaccatattt 29520846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 125 - 166
Target Start/End: Complemental strand, 32978161 - 32978120
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtc 166  Q
    |||||||||||||||| ||| |||||||||||||||||||||    
32978161 caacaacaacaacaaccaagccttatcccactaagttgggtc 32978120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 128 - 185
Target Start/End: Original strand, 39651026 - 39651083
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    ||||||||||||| ||| ||||||||||||||| ||||| |||| |||||| ||||||    
39651026 caacaacaacaaccaagccttatcccactaagtggggtcgggtatatggatcaaatta 39651083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 124 - 185
Target Start/End: Original strand, 41031414 - 41031475
Alignment:
124 gcaacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    ||||||||||||||||| ||| ||||||||||||||| ||||| | || |||||| ||||||    
41031414 gcaacaacaacaacaaccaagccttatcccactaagtggggtcggctatatggatcaaatta 41031475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 124 - 185
Target Start/End: Original strand, 41031520 - 41031581
Alignment:
124 gcaacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    ||||||||||||||||| ||| ||||||||||||||| ||||| | || |||||| ||||||    
41031520 gcaacaacaacaacaaccaagccttatcccactaagtggggtcggctatatggatcaaatta 41031581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 177
Target Start/End: Complemental strand, 1065007 - 1064955
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatgga 177  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||    
1065007 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatgga 1064955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 166
Target Start/End: Original strand, 16008391 - 16008431
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtc 166  Q
    ||||||||||||||| ||||||||||||||||||| |||||    
16008391 aacaacaacaacaaccaagtcttatcccactaagtggggtc 16008431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 26363768 - 26363684
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatataccatattt 214  Q
    ||||||||||| ||||||||||||||| ||| |||||   ||||||||| ||||||  | |  |||||||||||| |||||||||    
26363768 acaacaacaaccaagtcttatcccactgagtggggtcgactacatggatcaaattacactaagtgttctatcataaaccatattt 26363684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 131 - 214
Target Start/End: Original strand, 35362651 - 35362735
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||| ||| ||| ||||||||||| ||||  | | ||||||| |||||| ||||| ||||||||||||| |||||||||    
35362651 caacaacaaccaagccttttcccactaagtggggttggctgcatggatcaaattacgccataatgttctatcatacaccatattt 35362735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 42584643 - 42584556
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||  ||||||||||||||||||| ||||| | ||||  ||| |||||| | ||| ||||||||||||| |||||||||    
42584643 acaacaacaacaatcaagtcttatcccactaagtggggtcggctaca-agatcaaattacgtcataatgttctatcataaaccatattt 42584556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 23492318 - 23492231
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||  ||| |||||| |||||||| ||||| | ||||||||| |||| |  ||||| |||||||||||||| |||||||    
23492318 caacaacaacaaacaagccttatctcactaagtggggtcggctacatggattaaatgacaccatagtgttctatcatatatcatattt 23492231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 128 - 183
Target Start/End: Complemental strand, 30748747 - 30748692
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||||||||||||||| ||| || ||| ||||||| ||||||||| ||||    
30748747 caacaacaacaactaagtcttaacccgcttagtggggtcagctacatggatcaaat 30748692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 32276972 - 32276893
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcat 203  Q
    |||||||||||||||| |||  |||||||||||||| || ||   ||||||||| |||||| ||||| ||||||||||||    
32276972 caacaacaacaacaaccaagctttatcccactaagtgggttcgtctacatggatcaaattacgccataatgttctatcat 32276893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 35085134 - 35085185
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    |||||||||||||||||  ||||||||||||||| ||||| | |||||||||    
35085134 acaacaacaacaactaacccttatcccactaagtggggtcggctacatggat 35085185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 35324057 - 35323970
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | ||| ||||| |||||| | ||| || || ||| |||||||||||||    
35324057 caacaacaacaaccaagccttatcccactaagtggggtcggctacgtggatcaaattacgtcataatattttattatataccatattt 35323970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 160
Target Start/End: Complemental strand, 39947135 - 39947100
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagt 160  Q
    |||||||||||||||| |||||||||||||||||||    
39947135 caacaacaacaacaaccaagtcttatcccactaagt 39947100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 132 - 214
Target Start/End: Complemental strand, 16917462 - 16917380
Alignment:
132 aacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatataccatattt 214  Q
    ||||| ||| ||||||||||||||||||| ||| | | ||||||||| |||    | || |||||||||||||||||||||||    
16917462 aacaataaccaagtcttatcccactaagtggggacggctacatggatcaaaagcagtcaaatgttctatcatataccatattt 16917380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 129 - 175
Target Start/End: Original strand, 39953263 - 39953309
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatg 175  Q
    |||||||||||| ||||||||||||||||||| ||||| | ||||||    
39953263 aacaacaacaaccaagtcttatcccactaagtggggtcggctacatg 39953309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 183
Target Start/End: Complemental strand, 40813611 - 40813553
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||||||||| |||| |||||||||||||| ||||  | ||||||||| ||||    
40813611 caacaacaacaacaacgaagttttatcccactaagtggggttggctacatggatcaaat 40813553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 133 - 214
Target Start/End: Complemental strand, 44699745 - 44699663
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||| ||| ||| ||||||||||| ||||| | |||| |||| |||||| |||||| |||||||||||  |||||||||    
44699745 acaacaaccaagccttttcccactaagtggggtctgctacagggatcaaattacgccatagtgttctatcatgcaccatattt 44699663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 185
Target Start/End: Complemental strand, 1335606 - 1335553
Alignment:
132 aacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    ||||||||||||||| ||||||||||||| ||||| | |||||| || ||||||    
1335606 aacaacaactaagtcctatcccactaagtggggtcggctacatgaatcaaatta 1335553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 166
Target Start/End: Complemental strand, 1489796 - 1489755
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtc 166  Q
    ||||||||| |||||| ||||||||||||||||||| |||||    
1489796 caacaacaataacaaccaagtcttatcccactaagtggggtc 1489755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 166
Target Start/End: Complemental strand, 5205462 - 5205421
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtc 166  Q
    |||||| ||||||||| ||||||||||||||||||| |||||    
5205462 caacaataacaacaaccaagtcttatcccactaagtggggtc 5205421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 166
Target Start/End: Complemental strand, 24837978 - 24837937
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtc 166  Q
    |||||||||||||||| ||| ||||||||||||||| |||||    
24837978 caacaacaacaacaaccaagccttatcccactaagtggggtc 24837937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 26642789 - 26642736
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    ||||||||  ||||| |||||| ||||||||||||||||||||  |||||||||    
26642789 caacaacataaacaaataagtcgtatcccactaagttgggtcaactacatggat 26642736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 158
Target Start/End: Original strand, 32569705 - 32569738
Alignment:
125 caacaacaacaacaactaagtcttatcccactaa 158  Q
    |||||||||||||||| |||||||||||||||||    
32569705 caacaacaacaacaaccaagtcttatcccactaa 32569738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 35643603 - 35643691
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatataccatattt 214  Q
    |||||||||||||||| |||  |||||||||||||| ||||  | ||||||||| ||| || | ||  |||||||||||| |||||||||    
35643603 caacaacaacaacaaccaagcattatcccactaagtggggtaggctacatggatcaaaatatggca-gtgttctatcataaaccatattt 35643691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 36394943 - 36394996
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggat 178  Q
    ||||| |||||||||| ||| ||||||||||||||| ||||| | |||||||||    
36394943 caacaccaacaacaacgaagccttatcccactaagtggggtcggctacatggat 36394996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 128 - 184
Target Start/End: Complemental strand, 3473854 - 3473798
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatt 184  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | || |||||| |||||    
3473854 caacaacaacaacaaagccttatcccactaagtggggtcggctaaatggattaaatt 3473798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 147 - 214
Target Start/End: Original strand, 16035744 - 16035812
Alignment:
147 ttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||||||| |||||| || |||||| | ||| |||||||| |||| |||||||||    
16035744 ttatcccactaagtggggtcagctacatgaatcaaattacgtcataatgttctaccataaaccatattt 16035812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 18741919 - 18741859
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||| ||| ||||| ||||||||||||||||||| ||||| | ||| ||||| ||||||    
18741919 caacaataacgacaaccaagtcttatcccactaagtggggtcggctacttggatcaaatta 18741859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 18746883 - 18746823
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||| ||| ||||| ||||||||||||||||||| ||||| | ||| ||||| ||||||    
18746883 caacaataacgacaaccaagtcttatcccactaagtggggtcggctacttggatcaaatta 18746823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 128 - 160
Target Start/End: Complemental strand, 31309637 - 31309605
Alignment:
128 caacaacaacaactaagtcttatcccactaagt 160  Q
    ||||||||||||| |||||||||||||||||||    
31309637 caacaacaacaaccaagtcttatcccactaagt 31309605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 130 - 166
Target Start/End: Original strand, 32838891 - 32838927
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtc 166  Q
    ||||||||||| ||||||||||||||||||| |||||    
32838891 acaacaacaaccaagtcttatcccactaagtggggtc 32838927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 51; Significance: 5e-20; HSPs: 53)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 48508522 - 48508432
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||||| |||||||||||| |||||||||    
48508522 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccatagtgttctatcataaaccatattt 48508432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 125 - 201
Target Start/End: Original strand, 45374472 - 45374549
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatc 201  Q
    |||||||||||||||| ||| ||||||||||||||| ||||||| ||||||||| |||||| ||||| ||||||||||    
45374472 caacaacaacaacaaccaagccttatcccactaagtggggtcagctacatggattaaattacgccataatgttctatc 45374549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 125 - 216
Target Start/End: Complemental strand, 40991718 - 40991626
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttg 216  Q
    |||| ||||||||| | |||||||||| |||||||| ||||||| ||||||||| ||||||  ||||| |||||||||||| |||||||||||    
40991718 caacgacaacaacagccaagtcttatctcactaagtggggtcagctacatggatcaaattacaccataatgttctatcataaaccatattttg 40991626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 5169119 - 5169029
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||| | |||||||||    
5169119 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcaaaaaccatattt 5169029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 12096700 - 12096790
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
12096700 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 12096790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 54128662 - 54128576
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||| ||| ||||||||||||||| |||||   ||||||||| |||||| ||||| ||||||||||||| |||||||||    
54128662 aacaacaacaaccaagccttatcccactaagtggggtcgcctacatggatcaaattatgccataatgttctatcataaaccatattt 54128576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 127 - 223
Target Start/End: Original strand, 2133609 - 2133706
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttgcttcaac 223  Q
    |||||||||||||| ||| ||||||||||||||| |||||  |||||||||| |||| | |||||| |||||||||||| || |||||| | ||||||    
2133609 acaacaacaacaaccaagccttatcccactaagtggggtcgagtacatggatcaaatcacgccatagtgttctatcataaactatatttggattcaac 2133706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 38060996 - 38060911
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| || |||||||||||||||| ||||| | ||||||||| |||||| |||||  |||||||||||| |||||||||    
38060996 acaacaacaaccaattcttatcccactaagtggggtcggctacatggatcaaattacgccatggtgttctatcataaaccatattt 38060911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 7895875 - 7895965
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||| ||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
7895875 caacaacaacaacaaccaagccttatcccattaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 7895965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 47555327 - 47555417
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||  | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
47555327 caacaacaacaacaaccaagccttatcccactaagtggggttggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 47555417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 52927843 - 52927933
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||| ||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| ||||| ||||||| || || |||||||||    
52927843 caacaacatcaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattatgccataatgttctgtcgtaaaccatattt 52927933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 53262428 - 53262338
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||| ||| |||| | |||||| |||||||||| | |||||||||    
53262428 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatagatcaaatgacgccatagtgttctatcaaaaaccatattt 53262338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 146 - 214
Target Start/End: Original strand, 24541348 - 24541417
Alignment:
146 cttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||||| ||||| ||||||||||| |||||| ||||| |||||||||| || |||||||||    
24541348 cttatcccactaagtggggtcgggtacatggatcaaattacgccataatgttctatcctaaaccatattt 24541417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 38850403 - 38850318
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| |||||| ||||||| ||||| | ||||||||| |||||| | |||| |||||||||||| |||| ||||    
38850403 acaacaacaactaagttttatcctactaagtggggtcggctacatggatcaaattacgtcatagtgttctatcataaaccaaattt 38850318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 45486848 - 45486933
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatatt 213  Q
    |||||||||||| |||  |||||||||||||| ||| | | ||||||||| |||||| ||||| ||||||||||||| ||||||||    
45486848 aacaacaacaaccaagctttatcccactaagtggggccggctacatggatcaaattatgccataatgttctatcataaaccatatt 45486933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 210
Target Start/End: Original strand, 48734147 - 48734228
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccat 210  Q
    ||||||||||  ||| ||||||||||||||| ||||||| ||||||||| || ||| ||||| ||||||||||||| |||||    
48734147 acaacaacaatcaagccttatcccactaagtggggtcagctacatggatcaacttacgccataatgttctatcataaaccat 48734228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 127 - 192
Target Start/End: Original strand, 49503565 - 49503630
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| ||||||    
49503565 acaacaacaacaaccaagccttatcccactaagtagggtcggctacatggatcaaattacgccata 49503630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 212
Target Start/End: Original strand, 311304 - 311392
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatat 212  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | |||||| || |||| | |||||| |||||||||| | |||||||    
311304 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatgtatcaaatgacgccatagtgttctatcaaaaaccatat 311392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 216
Target Start/End: Complemental strand, 25191664 - 25191572
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttg 216  Q
    |||| ||||||||||| |||  |||||||||||||| || |||| ||||||||| |||| | |||||| |||||||||| | |||||||||||    
25191664 caacgacaacaacaaccaagcattatcccactaagtgggatcagctacatggatcaaatgacgccatagtgttctatcaaaaaccatattttg 25191572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 216
Target Start/End: Original strand, 42510011 - 42510103
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    |||||||||||||| | ||| ||| |||| |||||| ||||| | ||||||||| |||||| ||||| |||||| |||||| |||||||||||    
42510011 caacaacaacaacagccaagccttttccctctaagtggggtcggctacatggatcaaattacgccataatgttcaatcataaaccatattttg 42510103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 52156081 - 52156169
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||||  || ||||||||||||||| ||||| | ||||||||| | || | |||||| |||||||||||| |||||||||    
52156081 acaacaacaacaaccgagccttatcccactaagtggggtcggctacatggatcagatgacgccatagtgttctatcataaaccatattt 52156169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 130 - 212
Target Start/End: Original strand, 14415260 - 14415342
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatat 212  Q
    ||||||||||| ||||||||||||||||||| ||||| | ||||| ||| |||||| ||||| ||||| ||||||| |||||||    
14415260 acaacaacaaccaagtcttatcccactaagtggggtcggctacat-gatcaaattatgccataatgttatatcataaaccatat 14415342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 19676079 - 19676166
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||| |||||| ||| ||||||||||||||| ||||||| ||||||||| |||| | ||||| ||| ||||||||| | |||||||    
19676079 caacaataacaaccaagccttatcccactaagtggggtcagctacatggatcaaatcacgccataatgctctatcatacagcatattt 19676166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 37534200 - 37534287
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcatataccatattt 214  Q
    |||||||||||||| ||||| ||||||||||||  ||||||| ||||| ||| |||||| | || |||||| |||||| || ||||||    
37534200 acaacaacaacaaccaagtcatatcccactaagaagggtcagctacatagatcaaattacgacaaatgttcaatcataaactatattt 37534287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 52139084 - 52138997
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | | |||| |||||||||||| |||| ||||    
52139084 caacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaataacgtcatagtgttctatcatacaccaaattt 52138997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 22359 - 22269
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| |||  |||||||||||||| ||||| | ||||| ||| |||| | |||||| |||||||||| | |||||||||    
22359 caacaacaacaacaaccaagctttatcccactaagtggggtcggctacatagatcaaatgacgccatagtgttctatcaaaaaccatattt 22269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 175
Target Start/End: Complemental strand, 3987621 - 3987571
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatg 175  Q
    |||||||||||||||| |||||||||||||| |||| ||||| ||||||||    
3987621 caacaacaacaacaaccaagtcttatcccacaaagtggggtcgggtacatg 3987571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 126 - 204
Target Start/End: Complemental strand, 31146985 - 31146907
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccatatgttctatcata 204  Q
    |||||||||||||||  || ||||||||||||||| | ||| | ||||||||| ||||||  ||||||||| |||||||    
31146985 aacaacaacaacaaccgagccttatcccactaagtggagtcggctacatggatcaaattacaccatatgttttatcata 31146907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 39208895 - 39208805
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| | ||||||||||| | |||||   ||||||||| |||||| | ||| ||||||||||||| |||||||||    
39208895 caacaacaacaacaaccaagccatatcccactaactggggtcctctacatggatcaaattacgtcataatgttctatcataaaccatattt 39208805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 133 - 214
Target Start/End: Complemental strand, 49841895 - 49841813
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||| ||| |||| | | ||| || ||||||| ||||||||| |||||| |||||| ||||||||||||||||||||||    
49841895 acaacaaccaagccttacctcgctatgtggggtcagctacatggatcaaattatgccataatgttctatcatataccatattt 49841813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 39512826 - 39512773
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaa 182  Q
    |||||||||||| ||| ||||||||||||||| ||||| | |||||||||||||    
39512826 aacaacaacaaccaagccttatcccactaagtggggtcggctacatggataaaa 39512773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 40106620 - 40106705
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| |||||   ||||| ||| |||||| | ||| ||||||||||||| |||||||||    
40106620 acaacaacaaccaagccttatcccactaagtggggtccactacattgatcaaattatgtcataatgttctatcataaaccatattt 40106705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 45289091 - 45289176
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||  |  |||||||| |||||| || || ||||||||||||| |||||||||    
45289091 acaacaacaaccaagccttatcccactaagtggggttggcgacatggatcaaattatgctataatgttctatcataaaccatattt 45289176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 29601177 - 29601089
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||| ||| ||| | ||||||||||||| ||||||| ||||||||| ||||||   ||| ||||||||||||| || ||||||    
29601177 acaacaacaagaaccaagccgtatcccactaagtggggtcagctacatggatcaaattacatcataatgttctatcataaactatattt 29601089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 46148311 - 46148235
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||||| ||| |||  |||||||||| ||||| | ||||||||| |||||| ||||| |||||||||||||    
46148311 aacaacaacaaccaagccttgacccactaagtggggtcggctacatggatcaaattacgccataatgttctatcata 46148235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 211
Target Start/End: Original strand, 40273200 - 40273287
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccata 211  Q
    |||||||||||||||| ||  ||| ||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||| | ||||||    
40273200 caacaacaacaacaaccaaaccttttcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcaaaaaccata 40273287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 133 - 192
Target Start/End: Complemental strand, 41530040 - 41529981
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| ||||||    
41530040 acaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccata 41529981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 48532243 - 48532164
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtaca-tggataaaattaggccata-tgttctatcata 204  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | |||| ||||| |||| | |||||| ||||||||||||    
48532243 acaacaacaacaaccaagccttatcccactaagtggggtcggctacattggatcaaatgacgccatagtgttctatcata 48532164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 130 - 204
Target Start/End: Complemental strand, 49042219 - 49042144
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcata 204  Q
    ||||||||||| ||| |||||| ||| |||| ||||| | ||||||||| |||||| |||||| ||||||||||||    
49042219 acaacaacaaccaagccttatctcaccaagtggggtcggctacatggatcaaattacgccatagtgttctatcata 49042144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 168
Target Start/End: Complemental strand, 51027837 - 51027794
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcag 168  Q
    ||||||||| ||||||||||||||||||||||| || |||||||    
51027837 caacaacaataacaactaagtcttatcccactatgtggggtcag 51027794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 185
Target Start/End: Original strand, 344769 - 344827
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||||||||||| ||| ||||||| ||||||||||||| | ||||| ||| ||||||    
344769 acaacaacaacaaccaagccttatcctactaagttgggtcggctacatcgatgaaatta 344827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 388257 - 388347
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||| ||||| ||| ||||||||||||||| ||||  | ||||| ||| |||||| | ||| ||| ||||||||||||| |||||    
388257 caacaacaacgacaaccaagccttatcccactaagtggggttggctacattgatcaaattacgtcataatgctctatcatataccgtattt 388347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 130 - 211
Target Start/End: Original strand, 31566161 - 31566243
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccata 211  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| |  ||||| |||||||||| | ||||||    
31566161 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacaccatagtgttctatcaaaaaccata 31566243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 126 - 192
Target Start/End: Original strand, 45834596 - 45834662
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    ||||||||||||||| ||| ||||||||||||||| ||||  | ||||||||| |||| | ||||||    
45834596 aacaacaacaacaaccaagccttatcccactaagtggggttggctacatggatcaaatgacgccata 45834662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 183
Target Start/End: Complemental strand, 7278746 - 7278693
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    |||||||||||||||  |||||||||||||| ||||| | ||||||||| ||||    
7278746 acaacaacaactaagctttatcccactaagtggggtcggctacatggatcaaat 7278693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 202
Target Start/End: Original strand, 24778609 - 24778682
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatca 202  Q
    ||||||||| | ||| ||||||||||||||| ||||| | ||||||||| ||||||  |||| |||||||||||    
24778609 acaacaacagccaagccttatcccactaagtggggtcggctacatggatcaaattacaccataatgttctatca 24778682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 47233596 - 47233681
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||| | ||||| | |||||| || |||| | |||||| |||||||||| | |||||||||    
47233596 acaacaacaaccaagccttatcccactaactggggtcggctacatgaatcaaatgacgccatagtgttctatcaaaaaccatattt 47233681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 53519866 - 53519809
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaat 183  Q
    ||||||||||||||| ||| |||||| |||||||| ||||| | ||||||||| ||||    
53519866 aacaacaacaacaaccaagccttatctcactaagtggggtcggctacatggatcaaat 53519809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 130 - 201
Target Start/End: Complemental strand, 15296189 - 15296117
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatc 201  Q
    ||||||||||| ||| ||||||||||||||| ||||| |  |||||||| ||||||  |||| ||||||||||    
15296189 acaacaacaaccaagccttatcccactaagtggggtcggccacatggatcaaattacaccataatgttctatc 15296117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 19758152 - 19758085
Alignment:
146 cttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatatt 213  Q
    ||||||||||||||| ||||| | ||||||||| ||||||  ||||| |||||||||||| ||||||||    
19758152 cttatcccactaagtggggtc-gctacatggatcaaattataccataatgttctatcataaaccatatt 19758085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 128 - 160
Target Start/End: Complemental strand, 30704136 - 30704104
Alignment:
128 caacaacaacaactaagtcttatcccactaagt 160  Q
    |||||||||||||||| ||||||||||||||||    
30704136 caacaacaacaactaaatcttatcccactaagt 30704104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 37083291 - 37083367
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||||| ||| ||||||||||||||| ||||| | |||| |||  |||||| ||||| |||||| ||||||    
37083291 aacaacaacaaccaagccttatcccactaagtggggtcggctacaaggaccaaattacgccataatgttcgatcata 37083367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 51447714 - 51447802
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||| | ||| | | |||||| || |||| | |||||| |||||||||||| |||| ||||    
51447714 acaacaacaacaaccaagccttatcccactaaatggggccggctacatgaatcaaatgacgccatagtgttctatcatacaccaaattt 51447802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 65)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 9210700 - 9210789
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    ||||||||||||||| ||| ||||||||||||||| ||||||| ||||||||| |||||| ||||| ||||| ||||||| |||||||||    
9210700 aacaacaacaacaacgaagccttatcccactaagtggggtcagctacatggatcaaattacgccataatgttgtatcataaaccatattt 9210789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 28208323 - 28208413
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||||||||    
28208323 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcataaaccatattt 28208413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 127 - 216
Target Start/End: Original strand, 36101774 - 36101864
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    |||||||||||||| ||| ||||||||||||||| ||||||  ||||||||| |||||| | ||| ||||||||||||| |||||||||||    
36101774 acaacaacaacaaccaagccttatcccactaagtggggtcaactacatggatcaaattacgtcataatgttctatcataaaccatattttg 36101864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 130 - 214
Target Start/End: Original strand, 40979928 - 40980013
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||||| |||||||||||| |||||||||    
40979928 acaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccatagtgttctatcataaaccatattt 40980013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 2885719 - 2885807
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| ||||||  ||||| |||||||||||| |||||||||    
2885719 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacaccatagtgttctatcataaaccatattt 2885807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 12841270 - 12841360
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
12841270 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcataaaccaaattt 12841360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 125 - 209
Target Start/End: Original strand, 31682597 - 31682682
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatatacca 209  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| ||||    
31682597 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcataaacca 31682682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 39906368 - 39906457
Alignment:
126 aacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
39906368 aacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 39906457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 127 - 209
Target Start/End: Complemental strand, 42187726 - 42187642
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat--atgttctatcatatacca 209  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||||  ||||||||||||| ||||    
42187726 acaacaacaacaacaaagccttatcccactaagtggggtcggctacatggatcaaattacgccataaatgttctatcataaacca 42187642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 11594245 - 11594157
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| ||||    
11594245 acaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaattt 11594157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 45836479 - 45836567
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||||  || ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||||||||    
45836479 acaacaacaacaaccgagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcataaaccatattt 45836567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 27649063 - 27648977
Alignment:
129 aacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||||| |||| | |||||||||||| |||| ||||    
27649063 aacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaattacgccacagtgttctatcataaaccaaattt 27648977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 27893558 - 27893648
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| |||||| |||||||| ||||| | |||||| || |||||| ||||| ||||||||||||| | |||||||    
27893558 caacaacaacaacaaccaagccttatcgcactaagtagggtcggctacatgaatcaaattatgccataatgttctatcataaaacatattt 27893648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 133 - 214
Target Start/End: Original strand, 28627936 - 28628018
Alignment:
133 acaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||| ||||||||||||||| | ||| | ||||||||| |||||| ||||| ||||||||||||| |||| ||||    
28627936 acaacaactaagccttatcccactaagtggagtcggctacatggatcaaattacgccataatgttctatcataaaccacattt 28628018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 29650671 - 29650581
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | ||| || |||||||||| | |||||||||    
29650671 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccttagtgttctatcaaaaaccatattt 29650581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 43491595 - 43491505
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| ||||||   |||| |||||||||||| | |||||||    
43491595 caacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggatgaaattacatcatagtgttctatcataaatcatattt 43491505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 204
Target Start/End: Complemental strand, 4604834 - 4604754
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcata 204  Q
    |||||||||||| ||| ||||||||||||||||||| ||||  | ||||||||| ||| || ||||| |||||||||||||    
4604834 caacaacaacaagaaccaagtcttatcccactaagtggggttggctacatggatcaaagtacgccataatgttctatcata 4604754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 204
Target Start/End: Complemental strand, 6375155 - 6375075
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcata 204  Q
    ||||||| |||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| | |||||| ||||||||||||    
6375155 caacaacgacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcata 6375075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 131 - 214
Target Start/End: Complemental strand, 14057759 - 14057675
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||||||| ||||||| ||||  | ||||||||| ||||||  |||| ||||||||||||| |||||||||    
14057759 caacaacaactaagccttatcctactaagtggggttggctacatggatcaaattaccccataatgttctatcataaaccatattt 14057675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 131 - 214
Target Start/End: Complemental strand, 14367787 - 14367703
Alignment:
131 caacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatattt 214  Q
    |||||||||||||| ||||||| ||||||| ||||  | ||||||||| ||||||  |||| ||||||||||||| |||||||||    
14367787 caacaacaactaagccttatcctactaagtggggttggctacatggatcaaattaccccataatgttctatcataaaccatattt 14367703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 43281959 - 43281871
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||| ||| ||| ||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||| | |||||||||    
43281959 acaacaacaacaaccaagccttgtcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcaaaaaccatattt 43281871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 192
Target Start/End: Original strand, 44855164 - 44855236
Alignment:
120 gatcgcaacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata 192  Q
    |||| |||||||||||||||| ||| ||||||||||||||| ||||| | ||||||||  |||||| ||||||    
44855164 gatcacaacaacaacaacaaccaagccttatcccactaagtggggtcggctacatggaccaaattacgccata 44855236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 130 - 185
Target Start/End: Original strand, 20158671 - 20158726
Alignment:
130 acaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    ||||||||||| ||| ||||||||||||||| ||||||| ||||||||| ||||||    
20158671 acaacaacaaccaagccttatcccactaagtagggtcagctacatggatcaaatta 20158726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 125 - 223
Target Start/End: Complemental strand, 36652279 - 36652180
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattttgcttcaac 223  Q
    ||||||||||| ||||  || ||||||||||||||| ||||| | ||||||||| |||| | |||||| |||||||||||| |||| |||| | ||||||    
36652279 caacaacaacagcaaccgagccttatcccactaagtggggtcggctacatggatcaaatgacgccatagtgttctatcatacaccaaatttggattcaac 36652180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 37618229 - 37618142
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    ||||||||||||| ||| ||||||||||||||| ||||| | ||||||||| |||| |  ||||| |||||||||||| |||| ||||    
37618229 caacaacaacaaccaagccttatcccactaagtggggtcggctacatggatcaaatgacaccatagtgttctatcatacaccaaattt 37618142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 48515437 - 48515370
Alignment:
146 cttatcccactaagttgggtcaggtacatggataaaattaggccat-atgttctatcatataccatat 212  Q
    ||||||||||||||||||| | | |||||| ||||||||| ||||| ||||||||||||| |||||||    
48515437 cttatcccactaagttggggcggctacatgaataaaattacgccataatgttctatcataaaccatat 48515370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 22349907 - 22349817
Alignment:
125 caacaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaattaggccata-tgttctatcatataccatattt 214  Q
    |||||||||||||||  ||| ||||||||||||||| |||||   ||||||||| |||| | |||||| | ||||||||||||||| ||||    
22349907 caacaacaacaacaatcaagccttatcccactaagtggggtcgactacatggatcaaatgacgccatagtattctatcatataccaaattt 22349817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 128 - 216
Target Start/End: Complemental strand, 28355450 - 28355360
Alignment:
128 caacaacaacaactaagtcttatcccactaagttgggtcag-gtacatggataaaattaggccat-atgttctatcatataccatattttg 216  Q
    ||||||||||||| ||| ||||||||||||||| |||||||  ||| ||||| |||||  ||||| ||||| ||||||| |||||||||||    
28355450 caacaacaacaaccaagccttatcccactaagtggggtcagactacgtggatcaaattccgccataatgttttatcataaaccatattttg 28355360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 127 - 185
Target Start/End: Original strand, 29318792 - 29318850
Alignment:
127 acaacaacaacaactaagtcttatcccactaagttgggtcaggtacatggataaaatta 185  Q
    |||||||||||||| ||| |||||||||||||| |||||| | ||||||||| ||||||    
29318792 acaacaacaacaaccaagccttatcccactaagctgggtcggctacatggatcaaatta 29318850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]