View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9353-LTR4-TNT-insertion-6 (Length: 224)

Name: F9353-LTR4-TNT-insertion-6
Description: F9353-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9353-LTR4-TNT-insertion-6
F9353-LTR4-TNT-insertion-6
[»] chr1 (1 HSPs)
chr1 (8-215)||(10056676-10056883)


Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 215
Target Start/End: Complemental strand, 10056883 - 10056676
Alignment:
8 aaaataggatacacaccgaccgtgtaaatccaaactatactccactttatggtatatgtgcataaatatatatagttattcttattagatgttagtattt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10056883 aaaataggatacacaccgaccgtgtaaatccaaactatactccactttatggtatatgtgcataaatatatatagttattcttattagatgttagtattt 10056784  T
108 acacagtcacataatatatccattaaactgaaacttatatgggtcatttgatgaattttatttgtatacacaatcattgcggatatattttacaccgtca 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10056783 acacagtcacataatatatccattaaactgaaacttatatgggtcatttgatgaattttatttgtatacacaatcattgcggatatattttacaccgtca 10056684  T
208 atcaattg 215  Q
    ||||||||    
10056683 atcaattg 10056676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125365 times since January 2019
Visitors: 1457