View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9353-LTR4-TNT-insertion-8 (Length: 206)

Name: F9353-LTR4-TNT-insertion-8
Description: F9353-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9353-LTR4-TNT-insertion-8
F9353-LTR4-TNT-insertion-8
[»] chr2 (1 HSPs)
chr2 (10-196)||(37657773-37657959)


Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 196
Target Start/End: Complemental strand, 37657959 - 37657773
Alignment:
10 tcttcctttgatgtggtagaaattttgtcactcttgtgataacttagctgaacttctctatgatttttaagctccattggcgcaggagcctcagagtaat 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37657959 tcttcctttgatgtggtagaaattttgtcactcttgtgataacttagctgaacttctctatgatttttaagctccattggcgcaggagcctcagagtaat 37657860  T
110 gaacatcttccatggcttgaagtgctaccaagaagatatgagttatcaagagaaaaaccaagccaactttgctcattgtgaacatta 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37657859 gaacatcttccatggcttgaagtgctaccaagaagatatgagttatcaagagaaaaaccaagccaactttgctcattgtgaacatta 37657773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 191828 times since January 2019
Visitors: 2831