View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-10 (Length: 602)

Name: F9473H-LTR4-TNT-insertion-10
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9473H-LTR4-TNT-insertion-10
F9473H-LTR4-TNT-insertion-10
[»] chr7 (1 HSPs)
chr7 (8-593)||(26183825-26184410)
[»] scaffold0257 (1 HSPs)
scaffold0257 (34-370)||(15019-15354)
[»] chr2 (1 HSPs)
chr2 (527-587)||(24764798-24764858)
[»] chr6 (1 HSPs)
chr6 (48-107)||(24372331-24372390)


Alignment Details
Target: chr7 (Bit Score: 582; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 582; E-Value: 0
Query Start/End: Original strand, 8 - 593
Target Start/End: Original strand, 26183825 - 26184410
Alignment:
8 cctttgttccccataaagaggttgtggcaagttctttaagttttgctttgcaagacttttcagatgcgattcctcaaggtgtgttacctcattcaaacat 107  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26183825 cctttgttccccataaagatgttgtggcaagttctttaagttttgctttgcaagacttttcagatgcgattcctcaaggtgtgttacctcattcaaacat 26183924  T
108 acctgtgttggaattggcgtcagatgtagcgcacaatgacatacaaaattttgaagaggaaagaatacttcaggaaactaggatcgttgacattccaaag 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26183925 acctgtgttggaattggcgtcagatgtagcgcacaatgacatacaaaattttgaagaggaaagaatacttcaggaaactaggatcgttgacattccaaag 26184024  T
208 gatcatgttgattttgttccgcctgtttacaccgttgagcacgttgacgtgcatgaagaggtgggtggtaatgttttgtcccaggttagggaggttagtt 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26184025 gatcatgttgattttgttccgcctgtttacaccgttgagcacgttgacgtgcatgaagaggtgggtggtaatgttttgtcccaggttagggaggttagtt 26184124  T
308 cgtccactcagaccacagctgcacaagctgacactatggtgtcccctcaagatttggcagcggtctagttgcctgtacaacattttccccacgaagatgc 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26184125 cgtccactcagaccacagctgcacaagctgacactatggtgtcccctcaagatttggcagcggtctagttgcctgtacaacattttccccacgaagatgc 26184224  T
408 agatattgttgtcgattccgcacctatcagcctcctgtgacaaattctgaaatggttatggatgcctcattggatggaacttgcggtgacatcacttcaa 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26184225 agatattgttgtcgattccgcacctatcagcctcctgtgacaaattctgaaatggttatggatgcctcattggatggaacttgcggtgacatcacttcaa 26184324  T
508 gtcacattattacctcccgatagccggacccaaaatagtaggtgttgggatcacgtctgtcgtaactgaatccaccgttacaattg 593  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26184325 gtcacattattacctcccgatagccggacccaaaatagtaggtgttgggatcacgtctgtcgtaactgaatccaccgttacaattg 26184410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0257 (Bit Score: 61; Significance: 7e-26; HSPs: 1)
Name: scaffold0257
Description:

Target: scaffold0257; HSP #1
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 34 - 370
Target Start/End: Original strand, 15019 - 15354
Alignment:
34 gcaagttctttaagttttgctttgcaagacttttcagatgcgattcctcaaggtgtgttacctcattcaaacatacctgtgttggaattggcgtcagatg 133  Q
    ||||||||||| ||||||||||||||| |  ||||| | | |||||||| ||| ||||| ||||||||  |||| |||||||| |||||||| ||||| |    
15019 gcaagttcttttagttttgctttgcaaaatgtttcaaacgtgattcctctagg-gtgtttcctcattcggacatccctgtgttagaattggcatcagagg 15117  T
134 tagcgcacaatgacatacaaaattttgaagaggaaagaatacttcaggaaactaggatcgttgacattccaaaggatcatgttgattttgttccgcctgt 233  Q
     || |||| ||||  | ||||  ||||| ||||| ||||| ||||| ||||||  ||  |||| | ||||||||  ||  |||| ||  ||||||||| |    
15118 cagtgcacgatgatgtgcaaatatttgacgaggagagaattcttcaagaaactcagaatgttgtcgttccaaagagtctggttgtttcggttccgcctat 15217  T
234 ttacaccgttgagcacgttgacgtgcatgaagaggtgggtggtaatgttttgtcccaggttagggaggttagttcgtccactcagaccacagctgcacaa 333  Q
    ||||||  ||||||| |||||| ||||||||||| ||| |||||||||||||||||   | | || ||| | || |  |||||||| |||  || |||||    
15218 ttacactattgagcatgttgacatgcatgaagagttggatggtaatgttttgtcccttatcaagggggtgactttggtcactcagatcacgtcttcacaa 15317  T
334 gctgacactatggtgtcccctcaagatttggcagcgg 370  Q
    ||  |||| |||||||||||||||| | |||||||||    
15318 gcaaacaccatggtgtcccctcaagttgtggcagcgg 15354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 527 - 587
Target Start/End: Original strand, 24764798 - 24764858
Alignment:
527 atagccggacccaaaatagtaggtgttgggatcacgtctgtcgtaactgaatccaccgtta 587  Q
    |||||||||||||||||||| | |||||||||||| |||  ||||||  ||||||||||||    
24764798 atagccggacccaaaatagttgttgttgggatcacctctaccgtaaccaaatccaccgtta 24764858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 24372331 - 24372390
Alignment:
48 ttttgctttgcaagacttttcagatgcgattcctcaaggtgtgttacctcattcaaacat 107  Q
    |||| |||||||| || |||| ||||| ||||||||||||||||| ||||||||| ||||    
24372331 tttttctttgcaaaacgtttcggatgcaattcctcaaggtgtgtttcctcattcagacat 24372390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 38081 times since January 2019
Visitors: 1598