View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-11 (Length: 431)

Name: F9473H-LTR4-TNT-insertion-11
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9473H-LTR4-TNT-insertion-11
[»] chr5 (8 HSPs)
chr5 (8-421)||(10761350-10761763)
chr5 (8-421)||(10739007-10739421)
chr5 (8-225)||(10605971-10606192)
chr5 (260-374)||(10606395-10606510)
chr5 (297-374)||(10608144-10608221)
chr5 (8-82)||(10607485-10607559)
chr5 (8-87)||(10613894-10613973)
chr5 (300-352)||(9807759-9807811)
[»] chr6 (1 HSPs)
chr6 (282-352)||(12903595-12903665)

Alignment Details
Target: chr5 (Bit Score: 414; Significance: 0; HSPs: 8)
Name: chr5

Target: chr5; HSP #1
Raw Score: 414; E-Value: 0
Query Start/End: Original strand, 8 - 421
Target Start/End: Complemental strand, 10761763 - 10761350
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaagttaatttctaaatctaata 107  Q
10761763 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaagttaatttctaaatctaata 10761664  T
108 tacagaaaaaccatatggggagtttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatggaatt 207  Q
10761663 tacagaaaaaccatatggggagtttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatggaatt 10761564  T
208 gaagaaaatgcttatgttgctagagacattgatactaggtatcgggtccatgagcgtgtctgcaagctggtgataatccttttatgatcacatctaatag 307  Q
10761563 gaagaaaatgcttatgttgctagagacattgatactaggtatcgggtccatgagcgtgtctgcaagctggtgataatccttttatgatcacatctaatag 10761464  T
308 taatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtagcttgaaaaatgcaagaagtgaaacatttttgcttggaaatgttaccatg 407  Q
10761463 taatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtagcttgaaaaatgcaagaagtgaaacatttttgcttggaaatgttaccatg 10761364  T
408 gtgaatattgatta 421  Q
10761363 gtgaatattgatta 10761350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 8 - 421
Target Start/End: Complemental strand, 10739421 - 10739007
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaagttaatttctaaatctaata 107  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||    
10739421 taaaacaacccaaaatttaacagaaagcaaacatttcaaattgcttctatatatttatagtgtgcatataataatcacaatttaatttataaatctaata 10739322  T
108 tacagaaaaaccatatggggagtttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatggaatt 207  Q
     |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
10739321 cacagaaaaaccatatggggaatttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatagaatt 10739222  T
208 gaagaaaatgcttatgttgctagagacattgatactaggtatcgggtccatgagcgtgtctgcaa-gctggtgataatccttttatgatcacatctaata 306  Q
    |||| | |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
10739221 gaagcagatgcttatgttgctagagacattgatactaggaatcgggtccatcagcgtgtctgcaaggctggtgataatccttttatgatcacatctaata 10739122  T
307 gtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtagcttgaaaaatgcaagaagtgaaacatttttgcttggaaatgttaccat 406  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
10739121 gtaatgtcattcttgcaactttacttcttgaaatgtatgcaaaatgcggtagcttgaaaattgcaagaagtgaaacatttttgcttggaaatgttaccat 10739022  T
407 ggtgaatattgatta 421  Q
10739021 ggtgaatattgatta 10739007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 8 - 225
Target Start/End: Original strand, 10605971 - 10606192
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaagttaatttctaaatctaata 107  Q
    |||||||  ||||||||||  ||||| ||||||||| |||||||||||||||||| |||| |||||||||||||| |||| |  |||| ||||||| | |    
10605971 taaaacactccaaaatttataagaaatcaaacatttcaaattgcttctatatattcatagcgagcatataataattacaattgcatttataaatctgaca 10606070  T
108 tacagaa----aaaccatatggggagtttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatgg 203  Q
    |||||||    ||| | |||||||  ||| |||  ||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||    
10606071 tacagaagaaaaaaacctatgggggatttctttacaaaacttatgttattcctgataaacattgtggaaattgtattcatagttgcatagtgaaatatgg 10606170  T
204 aattgaagaaaatgcttatgtt 225  Q
    |||||| |||||| ||||||||    
10606171 aattgaggaaaattcttatgtt 10606192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 260 - 374
Target Start/End: Original strand, 10606395 - 10606510
260 agcgtgtctgcaag-ctggtgataatccttttatgatcacatctaatagtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtag 358  Q
    |||||||||||||| |||||||||||||||||||| |||||||||||| || | |||||||||||||||| ||||||||||||||||||||||| |||||    
10606395 agcgtgtctgcaaggctggtgataatccttttatggtcacatctaatactagtatcattcttgcaactttcattcttgaaatgtatgcaaaatgtggtag 10606494  T
359 cttgaaaaatgcaaga 374  Q
    |||||| | |||||||    
10606495 cttgaatattgcaaga 10606510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 297 - 374
Target Start/End: Original strand, 10608144 - 10608221
297 acatctaatagtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtagcttgaaaaatgcaaga 374  Q
    |||||| || |||||| |||||||||||||| ||||||||||||||||||| |||| |||||| |||| | |||||||    
10608144 acatctgattgtaatgacattcttgcaacttcaattcttgaaatgtatgcagaatgtggtagcctgaatattgcaaga 10608221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 10607485 - 10607559
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataat 82  Q
    |||||| ||||||||||||  ||||||||||| | | |  ||||||||||||||| |||||||||||||||||||    
10607485 taaaaccacccaaaatttataagaaagcaaacttattagtttgcttctatatattcatagtgagcatataataat 10607559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 10613894 - 10613973
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaa 87  Q
    |||||||||||||||  ||  |||| |||||||| | || ||||||||||||||| ||| ||||||||||||||| ||||    
10613894 taaaacaacccaaaaaatatgagaaggcaaacatatcaatttgcttctatatattcatactgagcatataataataacaa 10613973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 9807811 - 9807759
300 tctaatagtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatg 352  Q
    |||||||||||||| ||||||||||||   ||| ||||||||||||| |||||    
9807811 tctaatagtaatgttattcttgcaactgctattgttgaaatgtatgcgaaatg 9807759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 282 - 352
Target Start/End: Original strand, 12903595 - 12903665
282 aatccttttatgatcacatctaatagtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatg 352  Q
    ||||||||||||  |||||||| |  |||| |||||||||||||||  ||||||||||  |||||||||||    
12903595 aatccttttatggccacatctatttttaatttcattcttgcaacttccattcttgaaacatatgcaaaatg 12903665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 109790 times since January 2019
Visitors: 1349