View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-11 (Length: 431)

Name: F9473H-LTR4-TNT-insertion-11
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9473H-LTR4-TNT-insertion-11
F9473H-LTR4-TNT-insertion-11
[»] chr5 (8 HSPs)
chr5 (8-421)||(10761350-10761763)
chr5 (8-421)||(10739007-10739421)
chr5 (8-225)||(10605971-10606192)
chr5 (260-374)||(10606395-10606510)
chr5 (297-374)||(10608144-10608221)
chr5 (8-82)||(10607485-10607559)
chr5 (8-87)||(10613894-10613973)
chr5 (300-352)||(9807759-9807811)
[»] chr6 (1 HSPs)
chr6 (282-352)||(12903595-12903665)


Alignment Details
Target: chr5 (Bit Score: 414; Significance: 0; HSPs: 8)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 414; E-Value: 0
Query Start/End: Original strand, 8 - 421
Target Start/End: Complemental strand, 10761763 - 10761350
Alignment:
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaagttaatttctaaatctaata 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10761763 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaagttaatttctaaatctaata 10761664  T
108 tacagaaaaaccatatggggagtttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatggaatt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10761663 tacagaaaaaccatatggggagtttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatggaatt 10761564  T
208 gaagaaaatgcttatgttgctagagacattgatactaggtatcgggtccatgagcgtgtctgcaagctggtgataatccttttatgatcacatctaatag 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10761563 gaagaaaatgcttatgttgctagagacattgatactaggtatcgggtccatgagcgtgtctgcaagctggtgataatccttttatgatcacatctaatag 10761464  T
308 taatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtagcttgaaaaatgcaagaagtgaaacatttttgcttggaaatgttaccatg 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10761463 taatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtagcttgaaaaatgcaagaagtgaaacatttttgcttggaaatgttaccatg 10761364  T
408 gtgaatattgatta 421  Q
    ||||||||||||||    
10761363 gtgaatattgatta 10761350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 8 - 421
Target Start/End: Complemental strand, 10739421 - 10739007
Alignment:
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaagttaatttctaaatctaata 107  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||    
10739421 taaaacaacccaaaatttaacagaaagcaaacatttcaaattgcttctatatatttatagtgtgcatataataatcacaatttaatttataaatctaata 10739322  T
108 tacagaaaaaccatatggggagtttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatggaatt 207  Q
     |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
10739321 cacagaaaaaccatatggggaatttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatagaatt 10739222  T
208 gaagaaaatgcttatgttgctagagacattgatactaggtatcgggtccatgagcgtgtctgcaa-gctggtgataatccttttatgatcacatctaata 306  Q
    |||| | |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
10739221 gaagcagatgcttatgttgctagagacattgatactaggaatcgggtccatcagcgtgtctgcaaggctggtgataatccttttatgatcacatctaata 10739122  T
307 gtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtagcttgaaaaatgcaagaagtgaaacatttttgcttggaaatgttaccat 406  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
10739121 gtaatgtcattcttgcaactttacttcttgaaatgtatgcaaaatgcggtagcttgaaaattgcaagaagtgaaacatttttgcttggaaatgttaccat 10739022  T
407 ggtgaatattgatta 421  Q
    |||||||||||||||    
10739021 ggtgaatattgatta 10739007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 8 - 225
Target Start/End: Original strand, 10605971 - 10606192
Alignment:
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaagttaatttctaaatctaata 107  Q
    |||||||  ||||||||||  ||||| ||||||||| |||||||||||||||||| |||| |||||||||||||| |||| |  |||| ||||||| | |    
10605971 taaaacactccaaaatttataagaaatcaaacatttcaaattgcttctatatattcatagcgagcatataataattacaattgcatttataaatctgaca 10606070  T
108 tacagaa----aaaccatatggggagtttgtttcaaaaacttctgttattcctgatcaacaatgtggaaattgtattcatagttgcatagtgaaatatgg 203  Q
    |||||||    ||| | |||||||  ||| |||  ||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||    
10606071 tacagaagaaaaaaacctatgggggatttctttacaaaacttatgttattcctgataaacattgtggaaattgtattcatagttgcatagtgaaatatgg 10606170  T
204 aattgaagaaaatgcttatgtt 225  Q
    |||||| |||||| ||||||||    
10606171 aattgaggaaaattcttatgtt 10606192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 260 - 374
Target Start/End: Original strand, 10606395 - 10606510
Alignment:
260 agcgtgtctgcaag-ctggtgataatccttttatgatcacatctaatagtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtag 358  Q
    |||||||||||||| |||||||||||||||||||| |||||||||||| || | |||||||||||||||| ||||||||||||||||||||||| |||||    
10606395 agcgtgtctgcaaggctggtgataatccttttatggtcacatctaatactagtatcattcttgcaactttcattcttgaaatgtatgcaaaatgtggtag 10606494  T
359 cttgaaaaatgcaaga 374  Q
    |||||| | |||||||    
10606495 cttgaatattgcaaga 10606510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 297 - 374
Target Start/End: Original strand, 10608144 - 10608221
Alignment:
297 acatctaatagtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatgcggtagcttgaaaaatgcaaga 374  Q
    |||||| || |||||| |||||||||||||| ||||||||||||||||||| |||| |||||| |||| | |||||||    
10608144 acatctgattgtaatgacattcttgcaacttcaattcttgaaatgtatgcagaatgtggtagcctgaatattgcaaga 10608221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 10607485 - 10607559
Alignment:
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataat 82  Q
    |||||| ||||||||||||  ||||||||||| | | |  ||||||||||||||| |||||||||||||||||||    
10607485 taaaaccacccaaaatttataagaaagcaaacttattagtttgcttctatatattcatagtgagcatataataat 10607559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 10613894 - 10613973
Alignment:
8 taaaacaacccaaaatttaacagaaagcaaacatttgaaattgcttctatatatttatagtgagcatataataatcacaa 87  Q
    |||||||||||||||  ||  |||| |||||||| | || ||||||||||||||| ||| ||||||||||||||| ||||    
10613894 taaaacaacccaaaaaatatgagaaggcaaacatatcaatttgcttctatatattcatactgagcatataataataacaa 10613973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 9807811 - 9807759
Alignment:
300 tctaatagtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatg 352  Q
    |||||||||||||| ||||||||||||   ||| ||||||||||||| |||||    
9807811 tctaatagtaatgttattcttgcaactgctattgttgaaatgtatgcgaaatg 9807759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 282 - 352
Target Start/End: Original strand, 12903595 - 12903665
Alignment:
282 aatccttttatgatcacatctaatagtaatgtcattcttgcaactttaattcttgaaatgtatgcaaaatg 352  Q
    ||||||||||||  |||||||| |  |||| |||||||||||||||  ||||||||||  |||||||||||    
12903595 aatccttttatggccacatctatttttaatttcattcttgcaacttccattcttgaaacatatgcaaaatg 12903665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295392 times since January 2019
Visitors: 3016