View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-12 (Length: 353)

Name: F9473H-LTR4-TNT-insertion-12
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9473H-LTR4-TNT-insertion-12
F9473H-LTR4-TNT-insertion-12
[»] chr6 (2 HSPs)
chr6 (8-345)||(4182370-4182707)
chr6 (8-345)||(4743214-4743551)
[»] chr1 (2 HSPs)
chr1 (16-120)||(51756349-51756453)
chr1 (15-156)||(51855297-51855432)


Alignment Details
Target: chr6 (Bit Score: 338; Significance: 0; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 8 - 345
Target Start/End: Complemental strand, 4182707 - 4182370
Alignment:
8 tatacttgttctggttaacaatgattttacgagttattgttaaattatggtatgtggaatatgcggcttgagatattgctatgttcttttaatttattta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4182707 tatacttgttctggttaacaatgattttacgagttattgttaaattatggtatgtggaatatgcggcttgagatattgctatgttcttttaatttattta 4182608  T
108 tgggttagagttgcggttttgtcatcgtgcactatattttatatagttagtaaattattcaaatcttccaccatagattctcttatttttactctactac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4182607 tgggttagagttgcggttttgtcatcgtgcactatattttatatagttagtaaattattcaaatcttccaccatagattctcttatttttactctactac 4182508  T
208 tattttcaatatcatatagagatcgaatatttaaagttctgagacatccctttctggtagttgcttggtaatggtttgtatcttgcagttttaacagttg 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4182507 tattttcaatatcatatagagatcgaatatttaaagttctgagacatccctttctggtagttgcttggtaatggtttgtatcttgcagttttaacagttg 4182408  T
308 tctcatttacatctaatttatcttccaactctaaatta 345  Q
    ||||||||||||||||||||||||||||||||||||||    
4182407 tctcatttacatctaatttatcttccaactctaaatta 4182370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 8 - 345
Target Start/End: Complemental strand, 4743551 - 4743214
Alignment:
8 tatacttgttctggttaacaatgattttacgagttattgttaaattatggtatgtggaatatgcggcttgagatattgctatgttcttttaatttattta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4743551 tatacttgttctggttaacaatgattttacgagttattgttaaattatggtatgtggaatatgcggcttgagatattgctatgttcttttaatttattta 4743452  T
108 tgggttagagttgcggttttgtcatcgtgcactatattttatatagttagtaaattattcaaatcttccaccatagattctcttatttttactctactac 207  Q
    | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4743451 ttggttagagttgcggttttgtcatcgtgcactacattttatatagttagtaaattattcaaatcttccaccatagattctcttatttttactctactac 4743352  T
208 tattttcaatatcatatagagatcgaatatttaaagttctgagacatccctttctggtagttgcttggtaatggtttgtatcttgcagttttaacagttg 307  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4743351 tattttcaatatcataaagagatcgaatatttaaagttctgagacatccctttctggtagttgcttggtaatggtttgtatcttgcagttttaacagttg 4743252  T
308 tctcatttacatctaatttatcttccaactctaaatta 345  Q
    ||||||||||||||||||||||||||||||||||||||    
4743251 tctcatttacatctaatttatcttccaactctaaatta 4743214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 16 - 120
Target Start/End: Complemental strand, 51756453 - 51756349
Alignment:
16 ttctggttaacaatgattttacgagttattgttaaattatggtatgtggaatatgcggcttgagatattgctatgttcttttaatttatttatgggttag 115  Q
    ||||||||| ||||||  ||||| ||||||||||| ||||| | || | |||||| ||||||||| ||||||||||| |||| |||||||| |  |||||    
51756453 ttctggttaccaatgacattacgggttattgttaatttatgatgtgagaaatatgaggcttgagaaattgctatgttattttcatttatttgttagttag 51756354  T
116 agttg 120  Q
    |||||    
51756353 agttg 51756349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 15 - 156
Target Start/End: Original strand, 51855297 - 51855432
Alignment:
15 gttctggttaacaatgattttacgagttattgttaaattatggtatgtggaatatgcggcttgagatattgctatgttcttttaatttatttatgggtta 114  Q
    |||||||||| |||||| || ||| |||| |||| | ||||||| | ||||||||||||||||||| | ||||| ||| ||| |||||  ||||  ||||    
51855297 gttctggttaccaatgacttcacgggttactgttgatttatggtgtatggaatatgcggcttgagaaactgctacgttatttcaattttcttattagtta 51855396  T
115 gagttgcggttttgtcatcgtgcactatattttatatagtta 156  Q
    ||      |||||||||||||||| || ||||||||||||||    
51855397 ga------gttttgtcatcgtgcattacattttatatagtta 51855432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175395 times since January 2019
Visitors: 2677