View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-13 (Length: 321)

Name: F9473H-LTR4-TNT-insertion-13
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9473H-LTR4-TNT-insertion-13
[»] chr4 (1 HSPs)
chr4 (9-311)||(25901334-25901636)
[»] chr3 (2 HSPs)
chr3 (17-257)||(52002406-52002647)
chr3 (259-311)||(52002259-52002311)
[»] chr7 (1 HSPs)
chr7 (47-165)||(29010065-29010180)
[»] chr5 (1 HSPs)
chr5 (47-165)||(13148737-13148852)

Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 9 - 311
Target Start/End: Complemental strand, 25901636 - 25901334
9 ggagtgcagacacaagggttgaaatttgttgtgcacggaagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattca 108  Q
25901636 ggagtgcagacacaagggttgaaatttgttgtgcacggaagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattca 25901537  T
109 acaatatgttattagctgtttcaatgatttcacaatgcaggcttcttgctcagaggtacattagttactactcccttggttacattttaattgtcgcatt 208  Q
25901536 acaatatgttattagctgtttcaatgatttcacaatgcaggcttcttgctcagaggtacattagttactactcccttggttacattttaattgtcgcatt 25901437  T
209 tgtagtaaaaatgtgttttcatttctttgccatttttaaagttcaatgtgtatgtaaataacttttatttgacggttaaaaaggagccgagagagtaata 308  Q
25901436 tgtagtaaaaatgtgttttcatttctttgccatttttaaagttcaatgtgtatgtaaataacttttatttgacggttaaaaaggagccgagagagtaata 25901337  T
309 tta 311  Q
25901336 tta 25901334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 52002647 - 52002406
17 gacacaagggttgaaatttgttgtgcacggaagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattcaacaatatg 116  Q
    ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||   ||||||||||||||||||||| ||    
52002647 gacacaagggttgaaatttgttgtgcagggaagccagggttgttgctatccacagtaaacacattggaagcat---taggccttgagattcaacaatgtg 52002551  T
117 ttattagctgtttcaatgatttcacaatgcaggcttcttgctcagaggtacattagttact----actcccttggttacattttaattgtcgcatttgta 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    | | |||| ||||| ||||||  |||||| |||||    
52002550 ttattagctgtttcaatgatttcacaatgcaggcttcttgctcagaggtacattagttacttactaattccttagttactttttaaacgtcgcagttgta 52002451  T
213 gtaaaaatgtgttttcatttctttgccatttttaaagttcaatgt 257  Q
    ||||||||||||||||||||||| | | |||||||||||||||||    
52002450 gtaaaaatgtgttttcatttcttcgtcgtttttaaagttcaatgt 52002406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 311
Target Start/End: Complemental strand, 52002311 - 52002259
259 tatgtaaataacttttatttgacggttaaaaaggagccgagagagtaatatta 311  Q
    |||||||| |||||| ||||||| |||||||||||||||||  ||||||||||    
52002311 tatgtaaacaactttaatttgactgttaaaaaggagccgaggaagtaatatta 52002259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 47 - 165
Target Start/End: Original strand, 29010065 - 29010180
47 aagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattcaacaatatgttattagctgtttcaatgatttcacaatgc 146  Q
    |||||||| |||||  | || ||||| |||||||| |||||||   |||||||||||||||| || | |||||| ||| |||||||||||||  || |||    
29010065 aagccaggattgttactgtcaacagtgaacacattagaagcat---taggccttgagattcaccagtgtgttataagcagtttcaatgatttttcattgc 29010161  T
147 aggcttcttgctcagaggt 165  Q
    | || ||||||||||||||    
29010162 aagcatcttgctcagaggt 29010180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 47 - 165
Target Start/End: Complemental strand, 13148852 - 13148737
47 aagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattcaacaatatgttattagctgtttcaatgatttcacaatgc 146  Q
    |||||||| |||||  | || ||||| |||||||| |||||||   |||||||||||||||| || | |||||| ||| |||||||||||||  || |||    
13148852 aagccaggattgttactgtcaacagtgaacacattagaagcat---taggccttgagattcatcagtgtgttataagcagtttcaatgatttttcattgc 13148756  T
147 aggcttcttgctcagaggt 165  Q
    | || ||||||||||||||    
13148755 aagcatcttgctcagaggt 13148737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 14383 times since January 2019
Visitors: 566