View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-13 (Length: 321)

Name: F9473H-LTR4-TNT-insertion-13
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9473H-LTR4-TNT-insertion-13
F9473H-LTR4-TNT-insertion-13
[»] chr4 (1 HSPs)
chr4 (9-311)||(25901334-25901636)
[»] chr3 (2 HSPs)
chr3 (17-257)||(52002406-52002647)
chr3 (259-311)||(52002259-52002311)
[»] chr7 (1 HSPs)
chr7 (47-165)||(29010065-29010180)
[»] chr5 (1 HSPs)
chr5 (47-165)||(13148737-13148852)


Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 9 - 311
Target Start/End: Complemental strand, 25901636 - 25901334
Alignment:
9 ggagtgcagacacaagggttgaaatttgttgtgcacggaagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattca 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25901636 ggagtgcagacacaagggttgaaatttgttgtgcacggaagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattca 25901537  T
109 acaatatgttattagctgtttcaatgatttcacaatgcaggcttcttgctcagaggtacattagttactactcccttggttacattttaattgtcgcatt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25901536 acaatatgttattagctgtttcaatgatttcacaatgcaggcttcttgctcagaggtacattagttactactcccttggttacattttaattgtcgcatt 25901437  T
209 tgtagtaaaaatgtgttttcatttctttgccatttttaaagttcaatgtgtatgtaaataacttttatttgacggttaaaaaggagccgagagagtaata 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25901436 tgtagtaaaaatgtgttttcatttctttgccatttttaaagttcaatgtgtatgtaaataacttttatttgacggttaaaaaggagccgagagagtaata 25901337  T
309 tta 311  Q
    |||    
25901336 tta 25901334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 52002647 - 52002406
Alignment:
17 gacacaagggttgaaatttgttgtgcacggaagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattcaacaatatg 116  Q
    ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||   ||||||||||||||||||||| ||    
52002647 gacacaagggttgaaatttgttgtgcagggaagccagggttgttgctatccacagtaaacacattggaagcat---taggccttgagattcaacaatgtg 52002551  T
117 ttattagctgtttcaatgatttcacaatgcaggcttcttgctcagaggtacattagttact----actcccttggttacattttaattgtcgcatttgta 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    | | |||| ||||| ||||||  |||||| |||||    
52002550 ttattagctgtttcaatgatttcacaatgcaggcttcttgctcagaggtacattagttacttactaattccttagttactttttaaacgtcgcagttgta 52002451  T
213 gtaaaaatgtgttttcatttctttgccatttttaaagttcaatgt 257  Q
    ||||||||||||||||||||||| | | |||||||||||||||||    
52002450 gtaaaaatgtgttttcatttcttcgtcgtttttaaagttcaatgt 52002406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 311
Target Start/End: Complemental strand, 52002311 - 52002259
Alignment:
259 tatgtaaataacttttatttgacggttaaaaaggagccgagagagtaatatta 311  Q
    |||||||| |||||| ||||||| |||||||||||||||||  ||||||||||    
52002311 tatgtaaacaactttaatttgactgttaaaaaggagccgaggaagtaatatta 52002259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 47 - 165
Target Start/End: Original strand, 29010065 - 29010180
Alignment:
47 aagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattcaacaatatgttattagctgtttcaatgatttcacaatgc 146  Q
    |||||||| |||||  | || ||||| |||||||| |||||||   |||||||||||||||| || | |||||| ||| |||||||||||||  || |||    
29010065 aagccaggattgttactgtcaacagtgaacacattagaagcat---taggccttgagattcaccagtgtgttataagcagtttcaatgatttttcattgc 29010161  T
147 aggcttcttgctcagaggt 165  Q
    | || ||||||||||||||    
29010162 aagcatcttgctcagaggt 29010180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 47 - 165
Target Start/End: Complemental strand, 13148852 - 13148737
Alignment:
47 aagccagggttgttgatatccacagtaaacacattggaagcatcattaggccttgagattcaacaatatgttattagctgtttcaatgatttcacaatgc 146  Q
    |||||||| |||||  | || ||||| |||||||| |||||||   |||||||||||||||| || | |||||| ||| |||||||||||||  || |||    
13148852 aagccaggattgttactgtcaacagtgaacacattagaagcat---taggccttgagattcatcagtgtgttataagcagtttcaatgatttttcattgc 13148756  T
147 aggcttcttgctcagaggt 165  Q
    | || ||||||||||||||    
13148755 aagcatcttgctcagaggt 13148737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125036 times since January 2019
Visitors: 1417