View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-3 (Length: 270)

Name: F9473H-LTR4-TNT-insertion-3
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9473H-LTR4-TNT-insertion-3
F9473H-LTR4-TNT-insertion-3
[»] chr7 (1 HSPs)
chr7 (10-260)||(31415918-31416168)
[»] chr1 (1 HSPs)
chr1 (90-195)||(52329193-52329297)
[»] chr3 (1 HSPs)
chr3 (88-166)||(7938435-7938512)
[»] chr4 (1 HSPs)
chr4 (84-119)||(49278481-49278516)


Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 260
Target Start/End: Original strand, 31415918 - 31416168
Alignment:
10 ccatgcttatacacaacgacaataattatcccgaatttatcaagaatgaaaacaaaccaatcaaaatcagggttggtggggagaaaaatatggaaaatcc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31415918 ccatgcttatacacaacgacaataattatcccgaatttatcaagaatgaaaacaaaccaatcaaaatcagggttggtggggagaaaaatatggaaaatcc 31416017  T
110 taaaatagtgagtggcattagcatacatgcacatgtatcgtgaaacagtcgggaagcaatttttcgttttaaatagcatttttgatatnnnnnnnnnnnn 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                
31416018 taaaatagtgagtggcattagcatacatgcacatgtatcgtgaaacagtcgggaagcaatttttcgttttaaatagcatttttgatataaaaaagaaaaa 31416117  T
210 nnnnnnntgctaaacaacccaagaggatttatcccgatagcatcaagaatt 260  Q
           ||||||||||||||||||||||||||||||||||||||||||||    
31416118 aggaaaatgctaaacaacccaagaggatttatcccgatagcatcaagaatt 31416168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 90 - 195
Target Start/End: Original strand, 52329193 - 52329297
Alignment:
90 gagaaaaatatggaaaatcctaaaatagtgagtggcattagcatacatgc-acatgtatcgtgaaacagtcgggaagcaatttttcgttttaaatagcat 188  Q
    ||||||||||||||||||||||||||||||  ||  | |||||||||||| ||||||||||||||||| |||||||||   |||||| ||||||||||||    
52329193 gagaaaaatatggaaaatcctaaaatagtggatg--agtagcatacatgccacatgtatcgtgaaacactcgggaagcttattttcgctttaaatagcat 52329290  T
189 ttttgat 195  Q
    |||||||    
52329291 ttttgat 52329297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 88 - 166
Target Start/End: Complemental strand, 7938512 - 7938435
Alignment:
88 gggagaaaaatatggaaaatcctaaaatagtgagtggcattagcatacatg-cacatgtatcgtgaaacagtcgggaagc 166  Q
    ||||||||||||||||||||||||||||||||  ||  | | ||||||||| |||||||||||| ||||||||| |||||    
7938512 gggagaaaaatatggaaaatcctaaaatagtggatg--agtggcatacatgccacatgtatcgtaaaacagtcgagaagc 7938435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 84 - 119
Target Start/End: Original strand, 49278481 - 49278516
Alignment:
84 ggtggggagaaaaatatggaaaatcctaaaatagtg 119  Q
    ||||||||||||||||||||||||||||||||||||    
49278481 ggtggggagaaaaatatggaaaatcctaaaatagtg 49278516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 17997 times since January 2019
Visitors: 1567