View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-4 (Length: 554)

Name: F9473H-LTR4-TNT-insertion-4
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9473H-LTR4-TNT-insertion-4
[»] chr3 (1 HSPs)
chr3 (10-545)||(47368597-47369132)
[»] chr6 (1 HSPs)
chr6 (190-257)||(9685080-9685147)
[»] chr5 (1 HSPs)
chr5 (168-227)||(8132208-8132266)

Alignment Details
Target: chr3 (Bit Score: 515; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 515; E-Value: 0
Query Start/End: Original strand, 10 - 545
Target Start/End: Complemental strand, 47369132 - 47368597
10 atgtatgtggtagaagagatttggcaaatccaccgtatgtgtacattatctatttataaagcatgatttggagttatgtggtctccaactcaatgtcacc 109  Q
47369132 atgtatgtggtagaagagatttggcaaatccaccgtatgtgtacattatctatttataaagcatgatttggagttatgtggtctccaactcaatgtcacc 47369033  T
110 aagacactgaagttgcttatctgttgtaaattacgttattaatctttatgtcacatacatcaaatcacatcatagtgtcgcttttttaagttagtttcta 209  Q
47369032 aagacactgaagttgcttatctgttgtaaattacgttattaatctttatgtcacatacatcaaatcacatcatagtgtcgcttttttaagttagtttcta 47368933  T
210 aaatatctacatttatatctacataacgtgatttgattggatgcatgtatacaataagattagaatgattgtgtatacaaattaaatctataaactattt 309  Q
47368932 aaatatctacatttatatctacataacgtgatttgattggatgcatgtatacaataagattagaatgattgtgtatacaaattaaatctataaactattt 47368833  T
310 agaggatacacccaactatttggaaacatggaggaaaatttataagcagaaaaggaatgcctgtaaagtataaaccaaaaaagttaagaaattaacacnn 409  Q
47368832 agaggatacacccaactatttggaaacatggaggaaaatttataagcagaaaaggaatgcctgtaaagtataaaccaaaaaagttaagaaattaacactt 47368733  T
410 nnnnnctctgtaaatgaggttccataataccatttcttgatactgtaaacaccgaaaaatgatgtatattgatgcaatactacttttattattttataga 509  Q
47368732 tttttctctgtaaatgaggttccataataccatttcttgatactgtaaacaccgaaaaatgatgtatattgatgcaatactacttttattattttataga 47368633  T
510 cacactcacaactacactattctctgttcccaattg 545  Q
47368632 cacactcacaactacactattctctgttcccaattg 47368597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 190 - 257
Target Start/End: Original strand, 9685080 - 9685147
190 cttttttaagttagtttctaaaatatctacatttatatctacataacgtgatttgattggatgcatgt 257  Q
    ||||| |||||||||||||||||||||| ||   ||||||||||| | ||||||||||| ||||||||    
9685080 cttttataagttagtttctaaaatatctccagaaatatctacatatcttgatttgattgaatgcatgt 9685147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 168 - 227
Target Start/End: Original strand, 8132208 - 8132266
168 atcaaatcacatcatagtgtcgcttttttaagttagtttctaaaatatctacatttatat 227  Q
    ||||||||||||||||||| | ||||| |||||||||||||||||||||| ||| |||||    
8132208 atcaaatcacatcatagtg-cacttttataagttagtttctaaaatatctccatatatat 8132266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 426 times since January 2019
Visitors: 134