View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-4 (Length: 554)

Name: F9473H-LTR4-TNT-insertion-4
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9473H-LTR4-TNT-insertion-4
F9473H-LTR4-TNT-insertion-4
[»] chr3 (1 HSPs)
chr3 (10-545)||(47368597-47369132)
[»] chr6 (1 HSPs)
chr6 (190-257)||(9685080-9685147)
[»] chr5 (1 HSPs)
chr5 (168-227)||(8132208-8132266)


Alignment Details
Target: chr3 (Bit Score: 515; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 515; E-Value: 0
Query Start/End: Original strand, 10 - 545
Target Start/End: Complemental strand, 47369132 - 47368597
Alignment:
10 atgtatgtggtagaagagatttggcaaatccaccgtatgtgtacattatctatttataaagcatgatttggagttatgtggtctccaactcaatgtcacc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47369132 atgtatgtggtagaagagatttggcaaatccaccgtatgtgtacattatctatttataaagcatgatttggagttatgtggtctccaactcaatgtcacc 47369033  T
110 aagacactgaagttgcttatctgttgtaaattacgttattaatctttatgtcacatacatcaaatcacatcatagtgtcgcttttttaagttagtttcta 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47369032 aagacactgaagttgcttatctgttgtaaattacgttattaatctttatgtcacatacatcaaatcacatcatagtgtcgcttttttaagttagtttcta 47368933  T
210 aaatatctacatttatatctacataacgtgatttgattggatgcatgtatacaataagattagaatgattgtgtatacaaattaaatctataaactattt 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47368932 aaatatctacatttatatctacataacgtgatttgattggatgcatgtatacaataagattagaatgattgtgtatacaaattaaatctataaactattt 47368833  T
310 agaggatacacccaactatttggaaacatggaggaaaatttataagcagaaaaggaatgcctgtaaagtataaaccaaaaaagttaagaaattaacacnn 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
47368832 agaggatacacccaactatttggaaacatggaggaaaatttataagcagaaaaggaatgcctgtaaagtataaaccaaaaaagttaagaaattaacactt 47368733  T
410 nnnnnctctgtaaatgaggttccataataccatttcttgatactgtaaacaccgaaaaatgatgtatattgatgcaatactacttttattattttataga 509  Q
         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47368732 tttttctctgtaaatgaggttccataataccatttcttgatactgtaaacaccgaaaaatgatgtatattgatgcaatactacttttattattttataga 47368633  T
510 cacactcacaactacactattctctgttcccaattg 545  Q
    ||||||||||||||||||||||||||||||||||||    
47368632 cacactcacaactacactattctctgttcccaattg 47368597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 190 - 257
Target Start/End: Original strand, 9685080 - 9685147
Alignment:
190 cttttttaagttagtttctaaaatatctacatttatatctacataacgtgatttgattggatgcatgt 257  Q
    ||||| |||||||||||||||||||||| ||   ||||||||||| | ||||||||||| ||||||||    
9685080 cttttataagttagtttctaaaatatctccagaaatatctacatatcttgatttgattgaatgcatgt 9685147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 168 - 227
Target Start/End: Original strand, 8132208 - 8132266
Alignment:
168 atcaaatcacatcatagtgtcgcttttttaagttagtttctaaaatatctacatttatat 227  Q
    ||||||||||||||||||| | ||||| |||||||||||||||||||||| ||| |||||    
8132208 atcaaatcacatcatagtg-cacttttataagttagtttctaaaatatctccatatatat 8132266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125108 times since January 2019
Visitors: 1443