View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-6 (Length: 228)

Name: F9473H-LTR4-TNT-insertion-6
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9473H-LTR4-TNT-insertion-6
F9473H-LTR4-TNT-insertion-6
[»] chr5 (1 HSPs)
chr5 (8-218)||(4704675-4704885)


Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 218
Target Start/End: Complemental strand, 4704885 - 4704675
Alignment:
8 gtttccgcaaaattgatgtacacaattaaagacaacaatatgatactccatcagtttattatgagtgccatatttgaaatatttttccatctcaattttt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4704885 gtttccgcaaaattgatgtacacaattaaagacaacaatatgatactccatcagtttattatgagtgccatatttgaaatatttttccatctcaattttt 4704786  T
108 ccgtctcaaatttttagtcactttagaatatcaaagcaaatatttattatcttttttcaataataccctcatttatataaatagtctgtccacctatcta 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4704785 ccgtctcaaatttttagtcactttagaatatcaaagcaaatatttattatcttttttcaataataccctcatttatataaatagtctgtccacctatcta 4704686  T
208 ctcctatatta 218  Q
    |||||||||||    
4704685 ctcctatatta 4704675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 319137 times since January 2019
Visitors: 3040