View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-13 (Length: 672)

Name: J5-1-13
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-13
J5-1-13
[»] chr3 (2 HSPs)
chr3 (41-672)||(54201078-54201709)
chr3 (1-47)||(54201036-54201082)


Alignment Details
Target: chr3 (Bit Score: 611; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 611; E-Value: 0
Query Start/End: Original strand, 41 - 672
Target Start/End: Complemental strand, 54201709 - 54201078
Alignment:
41 attaatattgtgtaaatacaaatcctttgaattagccaactaaaaattgaaatttgcgtctcatttatagtatctatagtcgattttaaagtgtagtcag 140  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54201709 attaatattgtgtaaatacaaatcctttgaattagccaactaaaaattgaaatttgcgtctcatttatagtatctatagtcgattttaaagtgtagtcag 54201610  T
141 ttgttagccgttaaattaagagagatatttttctcttgacagcctgcaaccggctgcaccataaagccgtttgtcgaggatctaacttcctcaaaaataa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54201609 ttgttagccgttaaattaagagagatatttttctcttgacagcctgcaaccggctgcaccataaagccgtttgtcgaggatctaacttcctcaaaaataa 54201510  T
241 acatgtcgcctaatttataagctagctacttacccaagtccacaagaaataggctatttggaaagcattctgcaaaagaataatgnnnnnnntatattat 340  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||    
54201509 acatgtcgcctaatttataagctagctacttacccaagtccacaagaaataggctatttggaaagcattctgcaaaagaataatgaaaaaaatatattat 54201410  T
341 gagtaagttctgattgatcaagattgaactaaaatcaaagcatcttacacaatgttatgtgatatatactaacatcacaacaaatgatctattataaaat 440  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54201409 gagtaagttctgattgatcaagattgaactaaaatcaaagcatcttacacaatgttatgtgatatatactaacatcacaacaaatgatctattataaaat 54201310  T
441 gtgtatttacctggaataaggtaaaatgaatcaagaagatgatccaatgggggcgattaaaccaaaaatacttgttgttgggctctaccacgggcacacc 540  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54201309 gtgtatttacctggaataaggtaaaatgaatcaagaagatgatccaatgggggcgattaaaccaaaaatacttgttgttgggctctaccacgggcacacc 54201210  T
541 tcttacaattgtagtacgatcttggatttcttgagccatttccatgattatcagttcaagctttgtgcccactaataaaagtatctgtaaaagttgataa 640  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54201209 tcttacaattgtagtacgatcttggatttcttgagccatttccatgattatcagttcaagctttgtgcccactaataaaagtatctgtaaaagttgataa 54201110  T
641 acacagattttgaattgtaaacaccagtatta 672  Q
    ||||||||||||||||||||||||||||||||    
54201109 acacagattttgaattgtaaacaccagtatta 54201078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 54201082 - 54201036
Alignment:
1 tattatgctgatcatgttcatgtgcctaattataaaatccattaata 47  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
54201082 tattatgctgatcatgttcatgtgcctaattataaaatccattaata 54201036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105819 times since January 2019
Visitors: 1319