View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-2 (Length: 222)

Name: J5-1-2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-2
J5-1-2
[»] chr2 (3 HSPs)
chr2 (1-134)||(38785455-38785588)
chr2 (126-222)||(38785584-38785680)
chr2 (125-160)||(38782033-38782068)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 38785588 - 38785455
Alignment:
1 ccatggtcctttttcatattattcatgtagtgcaatatattatgctccaacgaagggtgatatttaggatgcaaagtgtaaaacttgtgtcggagggtgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38785588 ccatggtcctttttcatattattcatgtagtgcaatatattatgctccaacgaagggtgatatttaggatgcaaagtgtaaaacttgtgtcggagggtgt 38785489  T
101 ttttacataattgtaggacgcgcgagaaattaat 134  Q
    ||||||||||||||||||||||||||||||||||    
38785488 ttttacataattgtaggacgcgcgagaaattaat 38785455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 126 - 222
Target Start/End: Complemental strand, 38785680 - 38785584
Alignment:
126 gaaattaatggaagagaaactatcttaattttgaagtgtgtggttacttaggttacttttagagacatagttacacgaaggactattgaaagccatg 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38785680 gaaattaatggaagagaaactatcttaattttgaagtgtgtggttacttaggttacttttagagacatagttacacgaaggactattgaaagccatg 38785584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 160
Target Start/End: Complemental strand, 38782068 - 38782033
Alignment:
125 agaaattaatggaagagaaactatcttaattttgaa 160  Q
    |||||||||||||||||||||||||||| |||||||    
38782068 agaaattaatggaagagaaactatcttagttttgaa 38782033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110668 times since January 2019
Visitors: 1335