View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-34 (Length: 430)

Name: J5-1-34
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-34
J5-1-34
[»] chr2 (1 HSPs)
chr2 (1-427)||(26297491-26297917)


Alignment Details
Target: chr2 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 1 - 427
Target Start/End: Complemental strand, 26297917 - 26297491
Alignment:
1 cagtttcgcagttgcaagtcttaaagaatcagtagaaaccaaatcaacaggattaccaacacaagctcttcttttagaaatagttttcaaaccagaaact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26297917 cagtttcgcagttgcaagtcttaaagaatcagtagaaaccaaatcaacaggattaccaacacaagctcttcttttagaaatagttttcaaaccagaaact 26297818  T
101 cttggaacggaagaggaagcatcgttatcaaagcgagtgacgtaaacgaactgaccgagctggagtttatcagaacggattaactcggcgtcggagtcgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26297817 cttggaacggaagaggaagcatcgttatcaaagcgagtgacgtaaacgaactgaccgagctggagtttatcagaacggattaactcggcgtcggagtcgg 26297718  T
201 agacggagacataagcggagtgaagagagtcggagagtttgagaaagtagccggtggcgggctgaaatgtgtcttctgaaagacgagggatgatttcagt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
26297717 agacggagacataagcggagtgaagagagtcggagagtttgagaaagtagccggtggcgggttgaaatgtgtcttctgaaagacgagggatgatttcagt 26297618  T
301 tacttgaaggagtggttgacggtgggtgtttgttgaagtggagttttggagaagttttgggaggactccaggggttagagacgccattgttgtaaggaat 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
26297617 tacttgaaggagtggttgacggtgggtgtttgttgaagtggagttttggagaagttttgagaggactccaggggttagagacgccattgttgtaaggaat 26297518  T
401 agctctttttgaaatggctgcctcccc 427  Q
    ||||||||||||||||||||| |||||    
26297517 agctctttttgaaatggctgcttcccc 26297491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126195 times since January 2019
Visitors: 1390