View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-5 (Length: 202)

Name: J5-1-5
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-5
J5-1-5
[»] chr5 (4 HSPs)
chr5 (1-128)||(41228415-41228542)
chr5 (123-184)||(41228340-41228401)
chr5 (5-124)||(32643517-32643633)
chr5 (123-173)||(42783656-42783706)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 41228415 - 41228542
Alignment:
1 gtgaaatctcagggttggcatttaaaacaacaatttatcttaattcttgaatctccacttcaatggtatatgtagtttcaatggaaacaaatctgaaatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41228415 gtgaaatctcagggttggcatttaaaacaacaatttatcttaattcttgaatctccacttcaatggtatatgtagtttcaatggaaacaaatctgaaatg 41228514  T
101 ataattgatcccaatcctgtatattaat 128  Q
    ||||||||||||||||||||||||||||    
41228515 ataattgatcccaatcctgtatattaat 41228542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 123 - 184
Target Start/End: Original strand, 41228340 - 41228401
Alignment:
123 attaatattgttcacgtcctctctatataaagaaagttatgtttttcttgattatattctga 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41228340 attaatattgttcacgtcctctctatataaagaaagttatgtttttcttgattatattctga 41228401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 124
Target Start/End: Original strand, 32643517 - 32643633
Alignment:
5 aatctcagggttggcatttaaaacaacaatttatcttaattcttgaatctccacttcaatggtatatgtagtttcaatggaaacaaatctgaaatgataa 104  Q
    ||||||||||||||||||||||| ||||||| |||||||||| || ||||| | ||||||||  |||| ||||  ||||| ||||| ||||||||||  |    
32643517 aatctcagggttggcatttaaaataacaattcatcttaattc-tgtatctctatttcaatgg--tatgcagttctaatggtaacaactctgaaatgaata 32643613  T
105 ttgatcccaatcctgtatat 124  Q
     |||| |||||| |||||||    
32643614 ctgattccaatcatgtatat 32643633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 123 - 173
Target Start/End: Original strand, 42783656 - 42783706
Alignment:
123 attaatattgttcacgtcctctctatataaagaaagttatgtttttcttga 173  Q
    |||||| ||||||||||||||||| ||||||||||||||||||||| ||||    
42783656 attaatcttgttcacgtcctctctctataaagaaagttatgtttttgttga 42783706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108013 times since January 2019
Visitors: 1329