View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-52 (Length: 358)

Name: J5-1-52
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-52
J5-1-52
[»] chr7 (2 HSPs)
chr7 (1-321)||(46258016-46258336)
chr7 (318-358)||(46257980-46258020)
[»] chr1 (1 HSPs)
chr1 (16-90)||(37242087-37242161)
[»] chr4 (1 HSPs)
chr4 (3-85)||(49916791-49916873)
[»] chr8 (2 HSPs)
chr8 (244-286)||(5413950-5413992)
chr8 (246-306)||(6020487-6020546)
[»] chr6 (1 HSPs)
chr6 (242-302)||(27870915-27870975)


Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 46258016 - 46258336
Alignment:
1 ctcttttggctacaaagtgaccccatggcccatgtccatcaaatataccgcaaaatatcatgtcctcttggcatccaaattcctataatttaatacaata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46258016 ctcttttggctacaaagtgaccccatggcccatgtccatcaaatataccgcaaaatatcatgtcctcttggcatccaaattcctataatttaatacaata 46258115  T
101 gataggaccacaatgatgcagatggttaaccaccagaattgaattttatatcaaagacaaataaaatggttgattataaataggaccaaaaatgtaacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46258116 gataggaccacaatgatgcagatggttaaccaccagaattgaattttatatcaaagacaaataaaatggttgattataaataggaccaaaaatgtaacaa 46258215  T
201 gtacatgtttgtatacatgttgcgtttgacagaatcactgtcatgattttgacaaaagctacactttgaaggttaaacaaactcacggtgtcaccttgat 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46258216 gtacatgtttgtatacatgttgcgtttgacagaatcactgtcatgattttgacaaaagctacactttgaaggttaaacaaactcacggtgtcaccttgat 46258315  T
301 ttcgtcaaaactcccggaatt 321  Q
    |||||||||||||||||||||    
46258316 ttcgtcaaaactcccggaatt 46258336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 318 - 358
Target Start/End: Original strand, 46257980 - 46258020
Alignment:
318 aattgcatagcaaagaccttggcattgactctcttactctt 358  Q
    |||||||||||||||||||||||||||||||||||||||||    
46257980 aattgcatagcaaagaccttggcattgactctcttactctt 46258020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 16 - 90
Target Start/End: Complemental strand, 37242161 - 37242087
Alignment:
16 agtgaccccatggcccatgtccatcaaatataccgcaaaatatcatgtcctcttggcatccaaattcctataatt 90  Q
    |||||||||| || |||||||||||||| || || || || ||||||||||||||||||||||||||||||||||    
37242161 agtgaccccaaggtccatgtccatcaaaaatcccacagaagatcatgtcctcttggcatccaaattcctataatt 37242087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 3 - 85
Target Start/End: Complemental strand, 49916873 - 49916791
Alignment:
3 cttttggctacaaagtgaccccatggcccatgtccatcaaatataccgcaaaatatcatgtcctcttggcatccaaattccta 85  Q
    |||||||||||||| || ||||| || ||||| |||||||| |  || ||||| |||||||| | ||||||||||||||||||    
49916873 cttttggctacaaaatgtccccaaggaccatgcccatcaaaaactccacaaaacatcatgtcttgttggcatccaaattccta 49916791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 244 - 286
Target Start/End: Complemental strand, 5413992 - 5413950
Alignment:
244 tgattttgacaaaagctacactttgaaggttaaacaaactcac 286  Q
    ||||||||||||||||||||||||| || || |||||||||||    
5413992 tgattttgacaaaagctacactttggagcttcaacaaactcac 5413950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 246 - 306
Target Start/End: Complemental strand, 6020546 - 6020487
Alignment:
246 attttgacaaaagctacactttgaaggttaaacaaactcacggtgtcaccttgatttcgtc 306  Q
    |||||||||||||||||||||   || |||| |||| ||||| ||||||||||||||||||    
6020546 attttgacaaaagctacacttaatagcttaa-caaaatcacgttgtcaccttgatttcgtc 6020487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 242 - 302
Target Start/End: Original strand, 27870915 - 27870975
Alignment:
242 catgattttgacaaaagctacactttgaaggttaaacaaactcacggtgtcaccttgattt 302  Q
    |||||||||||||||| |||| |||||  |||| |||||| ||| ||||||||| ||||||    
27870915 catgattttgacaaaacctactctttgttggttcaacaaaatcatggtgtcaccgtgattt 27870975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175979 times since January 2019
Visitors: 1577