View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-55 (Length: 596)

Name: J5-1-55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-55
J5-1-55
[»] chr6 (2 HSPs)
chr6 (1-384)||(6698169-6698551)
chr6 (397-596)||(6698547-6698746)
[»] chr4 (1 HSPs)
chr4 (462-526)||(45401852-45401916)


Alignment Details
Target: chr6 (Bit Score: 376; Significance: 0; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 1 - 384
Target Start/End: Complemental strand, 6698551 - 6698169
Alignment:
1 ccattctctcatacacttcatagtgcttggttttatttcaacattatgtctatgtgtagggtcctacatgatcaagtcttcacacagtaagaatcaatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6698551 ccattctctcatacacttcatagtgcttggttttatttcaacattatgtctatgtgtagggtcctacatgatcaagtcttcacacagtaagaatcaatca 6698452  T
101 aggtcaagtaagaaatgcatcattacaaatttccaatttttggtccttttctagttatgatcgaaactgtttcgttgaggatactcaagaccattcacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6698451 aggtcaagtaagaaatgcatcattacaaatttccaatttttggtccttttctagttatgatcgaaactgtttcgttgaggatactcaagaccattcacaa 6698352  T
201 gtacttttggtgcagttttttatgcgctgaattatgcaacgccaaagggaacattgggttattgcaaactcaccggacccctcctcctccttcagttaca 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6698351 gtacttttggtgcagttttttatgcgctgaattatgcaacgccaaagggaacattgggttattgcaaactcaccggacccctcctcctccttcagttaca 6698252  T
301 cagcccaacattaaaattaatgctcactatgccactttccagtgagatatggctccataacaacactaagtttgaaggacaatt 384  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6698251 cag-ccaacattaaaattaatgctcactatgccactttccagtgagatatggctccataacaacactaagtttgaaggacaatt 6698169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 397 - 596
Target Start/End: Complemental strand, 6698746 - 6698547
Alignment:
397 ctctcatgttttctcaagtgtgtatatctctatgcttaaatcatactttttataaaatttctttttctcttttgtaatagaaggtgaagatttcgatgga 496  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6698746 ctctcatgttttctcaagtgtgtatatctctatgcttaaatcatactttttataaaatttctttttctcttttgtaatagaaggtgaagatttcgatgga 6698647  T
497 ctctcatttaatatgagaggatccattccccctaattggtaatttggtagtatctttctagacacaagctctcaaaaaatcttcaaattgctgaaccatt 596  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6698646 ctctcatttaatatgagaggatccattccccctaattggtaatttggtagtatctttctagacacaagctctcaaaaaatcttcaaattgctgaaccatt 6698547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 462 - 526
Target Start/End: Complemental strand, 45401916 - 45401852
Alignment:
462 tctcttttgtaatagaaggtgaagatttcgatggactctcatttaatatgagaggatccattccc 526  Q
    |||||||| |||||||||||||||||||  ||||| | |||| | | ||||||||||||||||||    
45401916 tctcttttataatagaaggtgaagattttaatggaatatcatatgacatgagaggatccattccc 45401852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 308003 times since January 2019
Visitors: 441