View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-62 (Length: 712)

Name: J5-1-62
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-62
J5-1-62
[»] chr3 (2 HSPs)
chr3 (63-712)||(54472152-54472799)
chr3 (1-68)||(54472795-54472862)


Alignment Details
Target: chr3 (Bit Score: 469; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 469; E-Value: 0
Query Start/End: Original strand, 63 - 712
Target Start/End: Original strand, 54472152 - 54472799
Alignment:
63 caattgagcgtgggtggtataatagcagttgcaggtgcagcttgtataatcctccttgtcgttatcctactctgcgttatatgtacaagaaggaagaaga 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
54472152 caattgagcgtgggtggtataatagcagttgcaggtgcagcttgtataatcctccttgtcattatcctactctgcgttatatgtacaagaaggaagaaga 54472251  T
163 gatcacaaccncatcacattcattactaccctactccagcacacggtatatatttttatatatctcctatttcnnnnnnnaataggaatttgcaaataag 262  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||    
54472252 gatcacaacctcatcacattcattactaccctactccagcacacggtatatatttttatatatctcctatttctttttttaataggaatttgcaaataag 54472351  T
263 catgttatgaagtttagaatagttnatgggggaagcnnnnnnnnnnnnnnnnnnnnnnnngattcatagcctattcttannnnnnngatcagaaatggat 362  Q
    |||||||||||||||||||||||| |||||||||||                        |||||||||||||||||||       ||||||||||||||    
54472352 catgttatgaagtttagaatagttaatgggggaagctaattaattaattaattaattaatgattcatagcctattcttatttttttgatcagaaatggat 54472451  T
363 cctctaaagcttttgcatgggggccatagtcgacgcggtagaggatccaaatttgaatcttatgtagctacaatatggtgttgcaaatgtagaaactgta 462  Q
    |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54472452 cctctaaagcttttgcatggtg-ccatagtcgacgcggtagaggatccaaatttgaatcttatgtagctacaatatggtgttgcaaatgtagaaactgta 54472550  T
463 agatatnnnnnnnnnntgttatctttgaatttatcantcccctggtcataaaggatctaatttgttcaaatcatttgttaaaaggctagttgtatatgtt 562  Q
    ||||||          |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54472551 agatataaaaaaaaaatgttatctttgaatttatcaatccc-tggtcataaaggatctaatttgttcaaatcatttgttaaaaggctagttgtatatgtt 54472649  T
563 gagtatgtgttataatgctaataagtgggagagtcaattaagcgaagcgagagtgacatgcctttttgaaccaacacagttacacgaaggtaagttgcga 662  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54472650 gagtatgtgttataatgctaataagtgggagagtcaattaagcgaagcgagagtgacatgcctttttgaaccaacacagttacacgaaggtaagttgcga 54472749  T
663 ggggtgattagggacacgggtttgaagcctgaaccgtaatatataaatac 712  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||    
54472750 ggggtgattagggacgcgggtttgaagcctgaaccgtaatatataaatac 54472799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 54472795 - 54472862
Alignment:
1 aatacaagttgtacaatttaaatcctattcttttaagatgacgatgatagaaaggaactgcacaattg 68  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54472795 aatacaagttgtacaatttaaatcctattcttttaagatgacgatgatagaaaggaactgcacaattg 54472862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310241 times since January 2019
Visitors: 444