View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-77 (Length: 850)

Name: J5-1-77
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-77
J5-1-77
[»] chr4 (24 HSPs)
chr4 (1-490)||(34359723-34360207)
chr4 (485-850)||(34359362-34359727)
chr4 (340-479)||(52732649-52732782)
chr4 (398-472)||(37445773-37445844)
chr4 (62-241)||(34354116-34354292)
chr4 (436-489)||(36805401-36805454)
chr4 (361-480)||(21045211-21045325)
chr4 (423-477)||(45049835-45049888)
chr4 (436-477)||(22212489-22212530)
chr4 (340-465)||(15501129-15501248)
chr4 (361-470)||(34096094-34096198)
chr4 (340-477)||(54512081-54512212)
chr4 (436-479)||(30022215-30022258)
chr4 (361-480)||(32140946-32141060)
chr4 (436-490)||(29840203-29840257)
chr4 (436-490)||(30492868-30492922)
chr4 (361-477)||(31817162-31817274)
chr4 (340-477)||(43421087-43421218)
chr4 (436-490)||(32140826-32140880)
chr4 (436-490)||(38692529-38692583)
chr4 (436-490)||(42672537-42672591)
chr4 (436-490)||(54092097-54092151)
chr4 (436-489)||(31987443-31987496)
chr4 (777-822)||(34353993-34354038)
[»] scaffold0072 (1 HSPs)
scaffold0072 (340-479)||(12040-12172)
[»] chr3 (27 HSPs)
chr3 (313-480)||(26965465-26965626)
chr3 (340-477)||(27483153-27483284)
chr3 (340-490)||(44648357-44648502)
chr3 (376-490)||(647539-647648)
chr3 (313-479)||(1340887-1341047)
chr3 (313-477)||(19552566-19552725)
chr3 (313-479)||(2567970-2568130)
chr3 (397-490)||(38165608-38165698)
chr3 (341-477)||(25061758-25061886)
chr3 (313-480)||(34059902-34060061)
chr3 (397-477)||(45095644-45095723)
chr3 (362-480)||(2662449-2662562)
chr3 (354-490)||(43580552-43580685)
chr3 (361-490)||(83377-83501)
chr3 (340-477)||(40048938-40049067)
chr3 (436-480)||(31290931-31290975)
chr3 (423-490)||(4392035-4392101)
chr3 (425-480)||(42857048-42857102)
chr3 (423-477)||(43599508-43599561)
chr3 (398-475)||(43600152-43600228)
chr3 (399-477)||(53716121-53716196)
chr3 (361-479)||(37225553-37225666)
chr3 (436-469)||(43736838-43736871)
chr3 (361-477)||(46362970-46363081)
chr3 (423-477)||(16240707-16240760)
chr3 (436-490)||(42791448-42791502)
chr3 (436-477)||(35099335-35099376)
[»] chr1 (22 HSPs)
chr1 (342-477)||(37437363-37437494)
chr1 (371-479)||(5317535-5317639)
chr1 (361-478)||(24040983-24041095)
chr1 (361-490)||(28751355-28751479)
chr1 (362-490)||(84465-84588)
chr1 (340-490)||(48259810-48259954)
chr1 (361-477)||(50349817-50349934)
chr1 (397-480)||(1430493-1430574)
chr1 (372-477)||(10690915-10691015)
chr1 (342-490)||(30006193-30006335)
chr1 (436-477)||(6377246-6377287)
chr1 (397-465)||(1428981-1429047)
chr1 (372-493)||(12002338-12002454)
chr1 (436-479)||(12851883-12851926)
chr1 (343-477)||(40060866-40060994)
chr1 (397-477)||(44583887-44583963)
chr1 (424-476)||(40719155-40719206)
chr1 (405-480)||(52403598-52403671)
chr1 (423-490)||(17919768-17919833)
chr1 (362-480)||(11650140-11650253)
chr1 (437-490)||(15698697-15698750)
chr1 (397-470)||(45749466-45749536)
[»] chr7 (15 HSPs)
chr7 (342-479)||(33056242-33056374)
chr7 (340-478)||(22627313-22627445)
chr7 (361-480)||(34002089-34002204)
chr7 (313-477)||(28044101-28044259)
chr7 (436-490)||(17869389-17869443)
chr7 (372-475)||(34733402-34733500)
chr7 (340-490)||(42121604-42121748)
chr7 (436-490)||(19920230-19920284)
chr7 (398-480)||(41905892-41905971)
chr7 (405-480)||(18886768-18886841)
chr7 (340-490)||(32275257-32275401)
chr7 (361-490)||(48838627-48838756)
chr7 (423-490)||(40298978-40299044)
chr7 (399-478)||(42259508-42259584)
chr7 (398-480)||(3680880-3680959)
[»] chr2 (16 HSPs)
chr2 (313-477)||(40987242-40987398)
chr2 (340-490)||(29795146-29795290)
chr2 (361-479)||(34225831-34225944)
chr2 (361-480)||(7743482-7743596)
chr2 (341-480)||(40410505-40410638)
chr2 (436-477)||(6592107-6592148)
chr2 (397-490)||(36360322-36360412)
chr2 (398-477)||(4840687-4840763)
chr2 (423-477)||(4536701-4536754)
chr2 (437-477)||(14511602-14511642)
chr2 (361-465)||(14378220-14378319)
chr2 (340-462)||(1381802-1381916)
chr2 (436-490)||(24775340-24775394)
chr2 (436-470)||(44228617-44228651)
chr2 (398-479)||(1298738-1298816)
chr2 (361-467)||(4766182-4766283)
[»] chr5 (17 HSPs)
chr5 (340-480)||(14980008-14980139)
chr5 (397-489)||(36660541-36660630)
chr5 (372-490)||(43257807-43257920)
chr5 (423-490)||(166596-166662)
chr5 (436-490)||(12992205-12992259)
chr5 (436-479)||(24436498-24436541)
chr5 (436-490)||(4751477-4751531)
chr5 (436-490)||(13066856-13066910)
chr5 (361-490)||(36783437-36783561)
chr5 (398-480)||(4967448-4967527)
chr5 (342-465)||(12167582-12167700)
chr5 (397-480)||(34919851-34919931)
chr5 (436-490)||(4742213-4742267)
chr5 (361-480)||(31889801-31889915)
chr5 (436-477)||(4371502-4371543)
chr5 (313-392)||(16886111-16886189)
chr5 (411-480)||(16886198-16886265)
[»] chr6 (7 HSPs)
chr6 (361-490)||(12828628-12828752)
chr6 (397-477)||(34439368-34439446)
chr6 (372-477)||(23936543-23936644)
chr6 (436-477)||(30627233-30627274)
chr6 (361-465)||(29915623-29915723)
chr6 (436-490)||(8052486-8052540)
chr6 (372-490)||(31275588-31275701)
[»] chr8 (14 HSPs)
chr8 (372-490)||(38329002-38329114)
chr8 (372-490)||(32326672-32326785)
chr8 (372-490)||(36915457-36915570)
chr8 (361-480)||(7612579-7612692)
chr8 (436-477)||(156371-156412)
chr8 (436-477)||(41414983-41415024)
chr8 (405-479)||(2067822-2067894)
chr8 (423-490)||(2812915-2812981)
chr8 (397-480)||(6839322-6839402)
chr8 (361-465)||(27109792-27109892)
chr8 (397-480)||(32737880-32737960)
chr8 (436-490)||(8106835-8106889)
chr8 (423-477)||(39970455-39970508)
chr8 (436-490)||(45187243-45187297)
[»] scaffold0580 (2 HSPs)
scaffold0580 (398-479)||(1690-1768)
scaffold0580 (398-479)||(9429-9507)
[»] scaffold0189 (1 HSPs)
scaffold0189 (436-489)||(13016-13069)
[»] scaffold0060 (1 HSPs)
scaffold0060 (436-490)||(31695-31749)


Alignment Details
Target: chr4 (Bit Score: 380; Significance: 0; HSPs: 24)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 1 - 490
Target Start/End: Original strand, 34359723 - 34360207
Alignment:
1 caatggtatagagctgatggtttgaccgtcttcttgtagtgcatgtgcaagtcttctggaccaaggtgttcacgcggtgtgtcctgatgagagcaagcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34359723 caatggtatagagctgatggtttgaccgtcttcttgtagtgcatgtgcaagtcttctggaccaaggtgttcacgcggtgtgtcctgatgagagcaagcaa 34359822  T
101 tgacggtgcaagtagatatgaatgaaaaagcttctgtttgaggagaagcgtattcatatgaattgattgactcacacttaagaggaatattatttgtatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34359823 tgacggtgcaagtagatatgaatgaaaaagcttctgtttgaggagaagcgtattcatatgaattgattgactcacacttaagaggaatattatttgtatt 34359922  T
201 tcaagagtgagagtctcacatttgatggaaaagttaaaagtggatgttgaacactgcttcctccgtttc-aaatgagngtcactttanctaaaatattta 299  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||    
34359923 tcaagagtgagagtctcacatttgatggaaaagttaaaagtggatgttgaacactgcttcctccgtttcaaaatgagtgtcactttagctaaaatattta 34360022  T
300 tttcaaaatgacgttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtt 399  Q
    |||||||||||| |||||||||||||||||        | |||||||||||||||||||| |||||| ||| ||| |||||| ||||||||||  | |||    
34360023 tttcaaaatgacattttcaatacaactttattttttttcttccaactttaccctctccaa-cttttctctcacacaattttcaatgcaacttt--aagtt 34360119  T
400 tgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    |||||||||| ||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34360120 tgtctttttc-ttataaagtaa-gggcagttta-gtaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 34360207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 485 - 850
Target Start/End: Original strand, 34359362 - 34359727
Alignment:
485 caattgtctcggaaatgagtgcaaactgctaagtctaaatgccttgaataaattgttttcgtgagttccaaggcaagataggacaatatatgatgtgtag 584  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34359362 caattgtctcggaaatgagtgcaaactgctaagtctaaatgccttgaataaattgttttcgtgagttccaaggcaagataggacaatatatgatgtgtag 34359461  T
585 cagcatatgacacgagtaatagcttaatggttagatcaagatttaacaaaaatttcacacccgaccaaatgcacattaattttcgtattgggtagtttac 684  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34359462 cagcatatgacacgagtaatagcttaatggttagatcaagatttaacaaaaatttcacacccgaccaaatgcacattaattttcgtattgggtagtttac 34359561  T
685 tgcaatggagtagcttgactgctttaacattcaatagaatgaagttgtgttttccagtnnnnnnnnttgcaaatggcttagatggagatgtggtctctct 784  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||    
34359562 tgcaatggagtagcttgactgctttaacattcaatagaatgaagttgtgttttccagtaaaaaaaattgcaaatggcttagatggagatgtggtctctct 34359661  T
785 cacttgtgtggttgttcttggtccaatgtgaatgatcttctgaactcttatcatggtccaacaatg 850  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34359662 cacttgtgtggttgttcttggtccaatgtgaatgatcttctgaactcttatcatggtccaacaatg 34359727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 340 - 479
Target Start/End: Original strand, 52732649 - 52732782
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||||||| ||||| ||||| ||| ||| |||||| |||||||||| |   |||||||||| | |||||||||||||| |||||||| ||||     
52732649 tccaactttaccctccccaac-ttttctctcacacaattttcaatgcaactttaat--tttgtctttt-ccttataaagtaaggg-cagtttagtaaaa- 52732742  T
440 gtgttatatctaatgattatttcatttcattccttaatct 479  Q
    |||||||||| ||||||||||||||| ||||  |||||||    
52732743 gtgttatatccaatgattatttcattccattttttaatct 52732782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 398 - 472
Target Start/End: Original strand, 37445773 - 37445844
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattcc 472  Q
    |||||||||||| |||||||||||||| |||||||| |||| ||||||| |||||||||||||||||||||||||    
37445773 tttgtctttttc-ttataaagtaaggg-cagtttagtaaaa-gtgttatgtctaatgattatttcatttcattcc 37445844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 62 - 241
Target Start/End: Original strand, 34354116 - 34354292
Alignment:
62 caaggtgttcacgcggtgtgtcctgatgagagcaagcaatgacggtgcaagtagatatgaatgaaaaagcttctgtttgaggagaagcgtattcatatga 161  Q
    |||||||||||   |||||||  || ||||||||||||| ||||| | ||||| |||||||||||||| ||||| |||||||| || | || |||||| |    
34354116 caaggtgttcaacgggtgtgttatgttgagagcaagcaacgacggggtaagtacatatgaatgaaaaaacttctatttgaggataaacatactcatatca 34354215  T
162 attgattga--ctcacacttaagaggaatattatttgtatttcaagagtgagagtctcacatttgatggaaaagttaaaagt 241  Q
    ||  || ||  | ||||||| ||||||| ||| ||||  ||||||||||   |||||||||||||||||||| || ||||||    
34354216 atatatggattcacacacttgagaggaagattgtttg--tttcaagagt---agtctcacatttgatggaaatgtcaaaagt 34354292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 436 - 489
Target Start/End: Complemental strand, 36805454 - 36805401
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaatt 489  Q
    ||||||||||| |||||||||||||||||||||||||||||||||  |||||||    
36805454 aaaagtgttatgtctaatgattatttcatttcattccttaatctgtgtgcaatt 36805401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 361 - 480
Target Start/End: Original strand, 21045211 - 21045325
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |   |||||||||||| |||||||||||||| |||||||  |||| |  ||||||| ||||||||||    
21045211 cttttctctcacacaattttcaatgcaactttaat--tttgtctttttc-ttataaagtaaggg-cagtttaataaaa-gccttatatccaatgattatt 21045305  T
461 tcatttcattccttaatctg 480  Q
    ||||| ||||||||||||||    
21045306 tcattccattccttaatctg 21045325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 423 - 477
Target Start/End: Original strand, 45049835 - 45049888
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    |||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||    
45049835 gggcagcttaggaaaa-gtgttatgtctaatgattatttcatttcattccttaat 45049888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 436 - 477
Target Start/End: Original strand, 22212489 - 22212530
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
22212489 aaaagtgttatgtctaatgattatttcatttcattccttaat 22212530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 340 - 465
Target Start/End: Complemental strand, 15501248 - 15501129
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    |||||| |||| |||| |||| ||||| ||| ||| |||||  |||||||||| |  |||||| |||||| |||||||||||||| |||||||| |||||    
15501248 tccaacattactctcttcaac-ttttctctcacacaatttttaatgcaactttaa--gtttgtatttttc-ttataaagtaaggg-cagtttagtaaaaa 15501154  T
440 gtgttatatctaatgattatttcatt 465  Q
     |||||| ||||||||||||||||||    
15501153 -tgttatgtctaatgattatttcatt 15501129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 361 - 470
Target Start/End: Original strand, 34096094 - 34096198
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| ||| |||||| |  ||||||||||||| |||||||||||||| || ||||| |||| ||||||  |||||||||||||    
34096094 cttttctctcacacaattttcaatgaaactttaa--gtttgtctttttc-ttataaagtaaggg-caatttagtaaaa-gtgttaagtctaatgattatt 34096188  T
461 tcatttcatt 470  Q
    ||||||||||    
34096189 tcatttcatt 34096198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 340 - 477
Target Start/End: Original strand, 54512081 - 54512212
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    |||||||||| |||||||||| ||||| ||| ||| || ||| |||||||||| |   |||||| ||||| |||||||||||| | |||||||| |||||    
54512081 tccaactttatcctctccaac-ttttctctcacacaatgttcaatgcaactttaat--tttgtcattttc-ttataaagtaagag-cagtttagtaaaaa 54512175  T
440 gtgttatatctaatgattatttcatttcattccttaat 477  Q
      |||||||| ||| |||||||||||||||| ||||||    
54512176 c-gttatatccaattattatttcatttcatttcttaat 54512212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 436 - 479
Target Start/End: Original strand, 30022215 - 30022258
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    ||||||||||||| |||||||||||| |||||||||||||||||    
30022215 aaaagtgttatatataatgattattttatttcattccttaatct 30022258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 361 - 480
Target Start/End: Complemental strand, 32141060 - 32140946
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||| |||  | |||||||||||   |||||||||| |||||||||||| |||| ||||||| |||||||||||||    
32141060 cttttctctcacacaattttcaatgcaaattt--atgtttgtcttttg-tttataaagta-ggggcagtttagtaaaa-gtgttatgtctaatgattatt 32140966  T
461 tcatttcattccttaatctg 480  Q
    |||||  ||| |||||||||    
32140965 tcattcaatttcttaatctg 32140946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 29840203 - 29840257
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||||||||||||||||| ||||||||||| ||  ||||||||    
29840203 aaaagtgttatgtctaatgattatttcattccattccttaatttgtgtgcaattg 29840257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 30492868 - 30492922
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||||||||||||||||| ||||||||||| ||  ||||||||    
30492868 aaaagtgttatgtctaatgattatttcattccattccttaatttgtgtgcaattg 30492922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 361 - 477
Target Start/End: Complemental strand, 31817274 - 31817162
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |   ||||| |||||  ||||||||||||||  ||||||| |||||  |||||||| ||||||||||    
31817274 cttttctctcacacaattttcaatgcaactttaat--tttgtattttttcttataaagtaaggga-agtttagtaaaaac-gttatatccaatgattatt 31817179  T
461 tcatttcattccttaat 477  Q
    ||||| |||| ||||||    
31817178 tcattccatttcttaat 31817162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 340 - 477
Target Start/End: Complemental strand, 43421218 - 43421087
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    |||||||||||||||||||   ||||| ||| ||| || ||| |||||||||| |   |||||||||||| |||||||||||| | || ||||| ||||     
43421218 tccaactttaccctctccagg-ttttctctcacacaatattcaatgcaactttaat--tttgtctttttc-ttataaagtaagag-caatttagtaaaa- 43421125  T
440 gtgttatatctaatgattatttcatttcattccttaat 477  Q
    || ||||||| ||||||||||||||| |||| ||||||    
43421124 gtattatatccaatgattatttcattccatttcttaat 43421087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 490
Target Start/End: Complemental strand, 32140880 - 32140826
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| | |||||||||||| ||||||||||||||| ||  ||||||||    
32140880 aaaagtgttatgtttaatgattatttgatttcattccttaatttgtgtgcaattg 32140826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 38692529 - 38692583
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| | | |||||||||||||||||||||||||| |  |||||||||    
38692529 aaaagtgttatctttgatgattatttcatttcattccttaatttatatgcaattg 38692583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 42672537 - 42672591
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| ||||||||||||||||||  |||||||||| ||  ||||||||    
42672537 aaaagtgttatgtctaatgattatttcattatattccttaatttgtgtgcaattg 42672591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 54092097 - 54092151
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    |||||| |||| | |||||| ||||||||||||||||||||| || |||||||||    
54092097 aaaagtattatgtttaatgactatttcatttcattccttaatttgtatgcaattg 54092151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 436 - 489
Target Start/End: Original strand, 31987443 - 31987496
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaatt 489  Q
    ||||||||||| ||||||||||||||||||| |||  ||||| || ||||||||    
31987443 aaaagtgttatctctaatgattatttcattttattttttaatttgtatgcaatt 31987496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 777 - 822
Target Start/End: Original strand, 34353993 - 34354038
Alignment:
777 gtctctctcacttgtgtggttgttcttggtccaatgtgaatgatct 822  Q
    |||||||||| |||| |||||||||||| ||||||||| |||||||    
34353993 gtctctctcatttgtatggttgttcttgatccaatgtggatgatct 34354038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072 (Bit Score: 60; Significance: 4e-25; HSPs: 1)
Name: scaffold0072
Description:

Target: scaffold0072; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 340 - 479
Target Start/End: Complemental strand, 12172 - 12040
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||||||||| ||| ||||| ||| ||| |||||| |||||||||| |  ||||||||||||| |||||||||||||  |||||||| ||||     
12172 tccaactttaccctctcaaac-ttttctctcacacaattttcaatgcaactttaa--gtttgtctttttc-ttataaagtaagg--cagtttagtaaaa- 12080  T
440 gtgttatatctaatgattatttcatttcattccttaatct 479  Q
    ||||||| |||||||||||||||||| |||||||||||||    
12079 gtgttatgtctaatgattatttcattccattccttaatct 12040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 2e-24; HSPs: 27)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 313 - 480
Target Start/End: Complemental strand, 26965626 - 26965465
Alignment:
313 ttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcntt 412  Q
    ||||||||||||||||||       | ||||||||||||||||||||| ||||| ||| ||| |||||| |||||||||| |   |||||||||||| ||    
26965626 ttttcaatacaactttaatttttttcttccaactttaccctctccaac-ttttctctcacacaattttcaatgcaactttaat--tttgtctttttc-tt 26965531  T
413 ataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    |||||||||||| |||||||| |||| | |||||||| |||||||||||||||| ||| |||||||||    
26965530 ataaagtaaggg-cagtttagtaaaa-gcgttatatccaatgattatttcattttatttcttaatctg 26965465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 340 - 477
Target Start/End: Complemental strand, 27483284 - 27483153
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||||||||||||| ||||| ||| ||  |||||| |||||||||| |  ||||||||||||| ||||||||||||||  | ||||| ||||     
27483284 tccaactttaccctctccaac-ttttctctcacataattttcaatgcaactttaa--gtttgtctttttc-ttataaagtaagggaaa-tttagtaaaa- 27483191  T
440 gtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||| ||||||||||||||||||||||||||||||    
27483190 gtgttatgtctaatgattatttcatttcattccttaat 27483153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 340 - 490
Target Start/End: Complemental strand, 44648502 - 44648357
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||| ||||||||| ||||  ||| ||| |||||| || ||||||| |  ||||||||||||  | ||||||||| || |||||||| ||||     
44648502 tccaactttactctctccaacttttt-tctcacacaattttcaattcaactttaa--gtttgtcttttttctcataaagtaaagg-cagtttagtaaaa- 44648408  T
440 gtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||| |||||||||||||||||||||||||||||||||  ||||||||    
44648407 gtgttatgtctaatgattatttcatttcattccttaatctgtgtgcaattg 44648357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 376 - 490
Target Start/End: Complemental strand, 647648 - 647539
Alignment:
376 attttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattcctta 475  Q
    |||||| |||||||||| |  ||||||||||||| |||||||||||||| |||||||| ||||  |||||||||||||||||||||||||||||| ||||    
647648 attttcaatgcaactttaa--gtttgtctttttc-ttataaagtaaggg-cagtttagtaaaac-tgttatatctaatgattatttcatttcatttctta 647554  T
476 atctggatgcaattg 490  Q
    |||||  ||||||||    
647553 atctgtgtgcaattg 647539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 313 - 479
Target Start/End: Complemental strand, 1341047 - 1340887
Alignment:
313 ttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcntt 412  Q
    ||||||||||||||||||       | |||||| ||||||||||||| |||||| ||| ||| |||||| ||||||||||  | ||||||||||||| ||    
1341047 ttttcaatacaactttaatttttttcttccaacgttaccctctccaa-cttttctctcacacaattttcaatgcaacttt--aagtttgtctttttc-tt 1340952  T
413 ataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    |||||||||  | || |||| ||||||||||||| |||||| ||||||||||| ||||| |||||||    
1340951 ataaagtaa-agacacttta-gaaaaagtgttatgtctaattattatttcattccattctttaatct 1340887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 313 - 477
Target Start/End: Original strand, 19552566 - 19552725
Alignment:
313 ttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcntt 412  Q
    ||||||||||||||||||       | ||||||||||||||||| ||| ||||| ||| ||  |||||| |||||||||| |   ||||| |||||| ||    
19552566 ttttcaatacaactttaaattttttcttccaactttaccctctctaac-ttttctctcacagaattttcaatgcaactttaat--tttgtatttttc-tt 19552661  T
413 ataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    |||||||||||  |||||||| |||||  |||||||| |||||||||||||||||||| ||||||    
19552662 ataaagtaagga-cagtttagtaaaaaacgttatatccaatgattatttcatttcatttcttaat 19552725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 313 - 479
Target Start/End: Complemental strand, 2568130 - 2567970
Alignment:
313 ttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcntt 412  Q
    ||||||||||||||||||       | |||||||||||||| || ||  ||||| ||| ||| |||||| |||||||||| |  ||||||||||||| ||    
2568130 ttttcaatacaactttaatttttttcttccaactttaccctttctaat-ttttctctcacacaattttcaatgcaactttaa--gtttgtctttttc-tt 2568035  T
413 ataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    |||||||||||  || ||| | |||| ||||||||||||||||||||||||||  ||||||||||||    
2568034 ataaagtaagga-catttttgtaaaa-gtgttatatctaatgattatttcattcaattccttaatct 2567970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 397 - 490
Target Start/End: Complemental strand, 38165698 - 38165608
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||||| |||||||||||||  |||||||| |||| ||||||| | |||||||||||||||| |||||||||||||| |||||||||    
38165698 gtttgtctttttc-ttataaagtaagga-cagtttagtaaaa-gtgttatgtttaatgattatttcattacattccttaatctgtatgcaattg 38165608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 341 - 477
Target Start/End: Original strand, 25061758 - 25061886
Alignment:
341 ccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaag 440  Q
    |||||||||| ||||||||| ||||| |||  || |||||| |||||||||| |  ||||||  ||||| ||||||||||||||  ||||||| |||| |    
25061758 ccaactttactctctccaac-ttttctctcatacaattttcaatgcaactttaa--gtttgt--ttttc-ttataaagtaagggt-agtttagtaaaa-g 25061849  T
441 tgttatatctaatgattatttcatttcattccttaat 477  Q
    |||||| ||||||||||||||||||||||||||||||    
25061850 tgttatgtctaatgattatttcatttcattccttaat 25061886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 313 - 480
Target Start/End: Original strand, 34059902 - 34060061
Alignment:
313 ttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcntt 412  Q
    ||||||||||||||||||       | | ||||||||||||||||||| ||||| ||| ||| |||||| |||||||||| |    ||||||||||| ||    
34059902 ttttcaatacaactttaatttttttctttcaactttaccctctccaac-ttttctctcgcacaattttcaatgcaactttaa----ttgtctttttc-tt 34059995  T
413 ataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    ||||||||||||  ||||||| ||||| | ||||||| ||| ||||||||||| |||| |||||||||    
34059996 ataaagtaagggt-agtttagtaaaaact-ttatatccaattattatttcattccatttcttaatctg 34060061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 397 - 477
Target Start/End: Original strand, 45095644 - 45095723
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||| ||||| ||||||||||||||||| ||||| |||| ||||||| | |||||||||||||||| |||||||||||    
45095644 gtttgtccttttc-ttataaagtaaggggcattttagtaaaatgtgttatgtttaatgattatttcattccattccttaat 45095723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 362 - 480
Target Start/End: Complemental strand, 2662562 - 2662449
Alignment:
362 ttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattattt 461  Q
    ||||| ||| ||| |||||| |||||||||| ||  |||||||||||| ||||||| |||||| || ||||| |||| ||||||| ||||||||||||||    
2662562 ttttctctcacacaattttcaatgcaactttaaa--tttgtctttttc-ttataaaataaggg-caatttagtaaaa-gtgttatgtctaatgattattt 2662468  T
462 catttcattccttaatctg 480  Q
    ||||| |||| ||||||||    
2662467 catttgattctttaatctg 2662449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 354 - 490
Target Start/End: Original strand, 43580552 - 43580685
Alignment:
354 ctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnt-tataaagtaaggggcagtttaggaaaaagtgttatatctaa 452  Q
    ||||||| ||||  ||| ||| |||||| |||||||||| ||  |||||||||||| | ||||||  ||||| |||||||| ||||| |||||||| |||    
43580552 ctccaactttttttctcacacaattttcaatgcaactttaaa--tttgtctttttcatatataaaacaaggg-cagtttagtaaaaa-tgttatatgtaa 43580647  T
453 tgattatttcatttcattccttaatctggatgcaattg 490  Q
    |||||||||||||  |||||||||||||  ||||||||    
43580648 tgattatttcattctattccttaatctgtgtgcaattg 43580685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 361 - 490
Target Start/End: Original strand, 83377 - 83501
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| | | |||||| |||||||||| |  ||||||||||||| ||||||||||||||  ||||||| |||| ||||| | ||||||||||| |    
83377 cttttctctcacgcaattttcaatgcaactttaa--gtttgtctttttc-ttataaagtaagggt-agtttagtaaaa-gtgttgtgtctaatgattaat 83471  T
461 tcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||||||||| ||  ||||||||    
83472 tcatttcattccttaatttgtgtgcaattg 83501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 340 - 477
Target Start/End: Original strand, 40048938 - 40049067
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    |||| |||||||||||||||| |||   ||| ||  |||||| |||||||||| ||  |||||||||||| |||||||||||  |||| ||||   ||||    
40048938 tccagctttaccctctccaactttt---ctctcataattttcaatgcaactttaaa--tttgtctttttc-ttataaagtaa-aggcaattta-ataaaa 40049029  T
440 gtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||| |||||||||||||||||| |||||||||||    
40049030 gtgttatgtctaatgattatttcattccattccttaat 40049067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 436 - 480
Target Start/End: Complemental strand, 31290975 - 31290931
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||    
31290975 aaaagtgttatgtctaataattatttcatttcattccttaatctg 31290931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 423 - 490
Target Start/End: Original strand, 4392035 - 4392101
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||| ||||||| |||||| |||||||||||||||| |||||| || |||||||||    
4392035 gggcagtttagtaaaa-gtgttatgtctaataattatttcatttcatttcttaatttgtatgcaattg 4392101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 425 - 480
Target Start/End: Complemental strand, 42857102 - 42857048
Alignment:
425 gcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    ||||||||| ||||| |||||| ||||||||||||||||||| |||||||||||||    
42857102 gcagtttagtaaaaa-tgttatgtctaatgattatttcatttgattccttaatctg 42857048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 423 - 477
Target Start/End: Complemental strand, 43599561 - 43599508
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| |||| || |||| ||||||||||||||||||||||||||||||    
43599561 gggcagtttagtaaaa-gtattatgtctaatgattatttcatttcattccttaat 43599508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 398 - 475
Target Start/End: Complemental strand, 43600228 - 43600152
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattcctta 475  Q
    |||||| ||||  ||||||||||| ||| ||||||| ||||| ||||||||||||| ||||||| |||||||| ||||    
43600228 tttgtcattttttttataaagtaaagggaagtttagtaaaaa-tgttatatctaataattattttatttcatttctta 43600152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 399 - 477
Target Start/End: Original strand, 53716121 - 53716196
Alignment:
399 ttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| |||||||||||| | |||||||| |||| | |||||||| |||||||||||||||||||| ||||||    
53716121 ttgtctttttc-ttataaagtaagag-cagtttagtaaaa-gcgttatatccaatgattatttcatttcatttcttaat 53716196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 361 - 479
Target Start/End: Complemental strand, 37225666 - 37225553
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |   |||||||||||| |||||||||||||  |||||||| |||| || ||||||| ||||||||||    
37225666 cttttctctcacacaattttcaatgcaactttaat--tttgtctttttc-ttataaagtaagga-cagtttagtaaaa-gtattatatccaatgattatt 37225572  T
461 tcatttcattccttaatct 479  Q
    |||||  ||| ||||||||    
37225571 tcattgtatttcttaatct 37225553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 436 - 469
Target Start/End: Complemental strand, 43736871 - 43736838
Alignment:
436 aaaagtgttatatctaatgattatttcatttcat 469  Q
    ||||||||||||||||||||||||||||||||||    
43736871 aaaagtgttatatctaatgattatttcatttcat 43736838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 477
Target Start/End: Complemental strand, 46363081 - 46362970
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||| | |||||||||| ||  ||||| |||||| |||||||||||||  |||||||| ||||| |||||  |||||||||||||    
46363081 cttttctctcacacaatttacaatgcaactttaaa--tttgtatttttc-ttataaagtaagga-cagtttagtaaaaa-tgttaggtctaatgattatt 46362987  T
461 tcatttcattccttaat 477  Q
    |||||  ||||||||||    
46362986 tcattcaattccttaat 46362970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 423 - 477
Target Start/End: Original strand, 16240707 - 16240760
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    |||| |||||| ||||| |||||| ||||||||||||||||||||||||| ||||    
16240707 gggctgtttagtaaaaa-tgttatgtctaatgattatttcatttcattccctaat 16240760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 42791448 - 42791502
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    |||||| |||| |||||||||||||||||| ||||||||||| ||  ||||||||    
42791448 aaaagtattatgtctaatgattatttcattacattccttaatatgcgtgcaattg 42791502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 436 - 477
Target Start/End: Complemental strand, 35099376 - 35099335
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| |||||||||||||||||||| || ||||||    
35099376 aaaagtgttatgtctaatgattatttcatttcgtttcttaat 35099335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 59; Significance: 2e-24; HSPs: 22)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 342 - 477
Target Start/End: Complemental strand, 37437494 - 37437363
Alignment:
342 caactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagt 441  Q
    |||||||| |||||| ||  ||||| ||| ||| |||||| |||||||||| |  ||||||||||||| |||||||||||||| || ||||| |||||||    
37437494 caactttatcctctctaattttttctctcacacaattttcaatgcaactttaa--gtttgtctttttc-ttataaagtaaggg-caatttagtaaaaagt 37437399  T
442 gttatatctaatgattatttcatttcattccttaat 477  Q
    ||||| |||||||| |||||||||||||||||||||    
37437398 gttatgtctaatgaatatttcatttcattccttaat 37437363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 371 - 479
Target Start/End: Complemental strand, 5317639 - 5317535
Alignment:
371 ccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcatt 470  Q
    |||| |||||| |||||||||| |  ||||||||||||| ||||||| ||||||||| ||||| |||| ||||||| |||||||||||||||||||||||    
5317639 ccacaattttcaatgcaactttaa--gtttgtctttttc-ttataaaataaggggcaatttagtaaaa-gtgttatgtctaatgattatttcatttcatt 5317544  T
471 ccttaatct 479  Q
    |||||||||    
5317543 ccttaatct 5317535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 361 - 478
Target Start/End: Complemental strand, 24041095 - 24040983
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |  ||||||||||||| |||||||||||||| |||||||| |||| ||||||| |||||||||||||    
24041095 cttttctctcacacaattttcaatgcaactttaa--gtttgtctttttc-ttataaagtaaggg-cagtttagtaaaa-gtgttatgtctaatgattatt 24041001  T
461 tcatttcattccttaatc 478  Q
    ||||| ||||||||||||    
24041000 tcattccattccttaatc 24040983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 361 - 490
Target Start/End: Complemental strand, 28751479 - 28751355
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| ||| |||||| |  ||||||| ||||| |||||||||||||| |||||||| ||||| |||||| |||||||||||||    
28751479 cttttctctcgcacaattttcaatgtaactttaa--gtttgtccttttc-ttataaagtaaggg-cagtttagtaaaaa-tgttatgtctaatgattatt 28751385  T
461 tcatttcattccttaatctggatgcaattg 490  Q
    | ||||||||||||||||||  ||||||||    
28751384 ttatttcattccttaatctgtgtgcaattg 28751355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 362 - 490
Target Start/End: Complemental strand, 84588 - 84465
Alignment:
362 ttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattattt 461  Q
    ||||| ||| ||| |||||| |||||||||| |  ||||||||||||| |||||||||||||  || ||||| |||| ||||||| ||||||||||||||    
84588 ttttctctcgcacaattttcaatgcaactttaa--gtttgtctttttc-ttataaagtaagga-cattttagtaaaa-gtgttatgtctaatgattattt 84494  T
462 catttcattccttaatctggatgcaattg 490  Q
    ||||  |||||||||||||  ||||||||    
84493 cattcaattccttaatctgtgtgcaattg 84465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 340 - 490
Target Start/End: Complemental strand, 48259954 - 48259810
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||||||||| ||| |||||  || ||| |||||| |||||||||| |  |||| |||||||| |||||||| ||||| |||||||  ||||     
48259954 tccaactttaccctctcaaac-ttttctttcacacaattttcaatgcaactttaa--gtttatctttttc-ttataaagcaaggg-cagtttaataaaa- 48259861  T
440 gtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||| ||||| ||||||||||||  |||||||||||||  ||||||||    
48259860 gtgttatgtctaacgattatttcattctattccttaatctgtgtgcaattg 48259810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 361 - 477
Target Start/End: Complemental strand, 50349934 - 50349817
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnt-----tataaagtaaggggcagtttaggaaaaagtgttatatctaatga 455  Q
    |||||| ||| ||| |||||| |||||||||| |  ||||||||||||| |     ||||||||||||| |||||||| |||| ||||||| ||||||||    
50349934 cttttctctcacacaattttcaatgcaactttaa--gtttgtctttttcttataattataaagtaaggg-cagtttagtaaaa-gtgttatgtctaatga 50349839  T
456 ttatttcatttcattccttaat 477  Q
    |||||||||| |||||||||||    
50349838 ttatttcattccattccttaat 50349817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 397 - 480
Target Start/End: Complemental strand, 1430574 - 1430493
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    ||||||||||||| ||||||||||| | ||||||||| |||| |||||||||||||| |||||||||||  ||| |||||||||    
1430574 gtttgtctttttc-ttataaagtaaagtgcagtttagtaaaa-gtgttatatctaattattatttcattaaatttcttaatctg 1430493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 372 - 477
Target Start/End: Complemental strand, 10691015 - 10690915
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| |  ||||||||||||| |||  ||||||| | |||||||| ||||| ||||||||||||||||||||||||||||||     
10691015 cacaattttcaatgcaactttaa--gtttgtctttttc-ttacgaagtaagtg-cagtttagtaaaaa-tgttatatctaatgattatttcatttcattt 10690921  T
472 cttaat 477  Q
    ||||||    
10690920 cttaat 10690915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 342 - 490
Target Start/End: Original strand, 30006193 - 30006335
Alignment:
342 caactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagt 441  Q
    ||||||||||||||||||| ||||| |||  || |||||| |||||||||| ||  ||| |||||||| |||||||||||| | || ||||| || | ||    
30006193 caactttaccctctccaac-ttttctctcaaacaattttcaatgcaactttaaa--tttatctttttc-ttataaagtaagag-caatttagtaata-gt 30006286  T
442 gttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||| ||||||||||||||||||  |||| ||||||||  ||||||||    
30006287 gttatgtctaatgattatttcattcaattcattaatctgtgtgcaattg 30006335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 436 - 477
Target Start/End: Complemental strand, 6377287 - 6377246
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
6377287 aaaagtgttatgtctaatgattatttcatttcattccttaat 6377246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 397 - 465
Target Start/End: Original strand, 1428981 - 1429047
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatt 465  Q
    ||||||| ||||| ||||||||||| ||||||||||| |||| |||||||||||||| |||||||||||    
1428981 gtttgtccttttc-ttataaagtaaagggcagtttagtaaaa-gtgttatatctaataattatttcatt 1429047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 372 - 493
Target Start/End: Original strand, 12002338 - 12002454
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| |  ||||||||||||| | |||||  ||||| |||||||| |||| || |||| ||| ||||||||||||||||||||    
12002338 cacaattttcaatgcaactttaa--gtttgtctttttcat-ataaaacaaggg-cagtttagtaaaa-gtattatgtctgatgattatttcatttcattc 12002432  T
472 cttaatctggatgcaattgtct 493  Q
    |||||| ||  |||||||||||    
12002433 cttaatatgtgtgcaattgtct 12002454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 436 - 479
Target Start/End: Original strand, 12851883 - 12851926
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    |||||||||||| ||||||||||||| |||||||||||||||||    
12851883 aaaagtgttatacctaatgattattttatttcattccttaatct 12851926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 343 - 477
Target Start/End: Complemental strand, 40060994 - 40060866
Alignment:
343 aactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtg 442  Q
    |||||||||||||||||| ||||| ||  ||  |||||| |||||||| | ||   || |||||||| |||||||||||||| || ||||| |||| |||    
40060994 aactttaccctctccaac-ttttctcttacaaaattttcaatgcaactataaaa--ttatctttttc-ttataaagtaaggg-caatttagtaaaa-gtg 40060901  T
443 ttatatctaatgattatttcatttcattccttaat 477  Q
    |||| |||||| |||||||||||||||| ||||||    
40060900 ttatgtctaatcattatttcatttcatttcttaat 40060866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 397 - 477
Target Start/End: Original strand, 44583887 - 44583963
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||||| ||||||| |||||  |||||||||||||  |||||| |||||||||||||| |||||||| ||||||    
44583887 gtttgtctttttc-ttataaaataagg--cagtttaggaaaat-tgttatgtctaatgattattttatttcatttcttaat 44583963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 424 - 476
Target Start/End: Original strand, 40719155 - 40719206
Alignment:
424 ggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaa 476  Q
    |||||||||| ||||| ||| || |||||||||||||||||||||||||||||    
40719155 ggcagtttagtaaaaa-tgtgatgtctaatgattatttcatttcattccttaa 40719206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 405 - 480
Target Start/End: Original strand, 52403598 - 52403671
Alignment:
405 ttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    ||||| |||||||||||||| |||||||  || | |||||||||| ||||||||||||||| |||| |||||||||    
52403598 ttttccttataaagtaaggg-cagtttaataaca-gtgttatatccaatgattatttcattccatttcttaatctg 52403671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 423 - 490
Target Start/End: Complemental strand, 17919833 - 17919768
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||| ||||||| | |||||||||||||||||||||| |||||||| ||| |||||    
17919833 gggcagtttagtaaaa-gtgttatgt-taatgattatttcatttcattcattaatctgtatgtaattg 17919768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 362 - 480
Target Start/End: Original strand, 11650140 - 11650253
Alignment:
362 ttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattattt 461  Q
    ||||| ||| ||| |||| | |||||||||| |  ||||||||||||| || ||||||||||| |||||||| ||||| |  ||||||||||| ||||||    
11650140 ttttctctcacacaatttccaatgcaactttaa--gtttgtctttttcttt-taaagtaaggg-cagtttagtaaaaa-tactatatctaatggttattt 11650234  T
462 catttcattccttaatctg 480  Q
    ||||  ||| |||||||||    
11650235 cattcaatttcttaatctg 11650253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 437 - 490
Target Start/End: Complemental strand, 15698750 - 15698697
Alignment:
437 aaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    |||||||||| |||||||||||||| |||| |||||||||| ||  ||||||||    
15698750 aaagtgttatgtctaatgattatttaattttattccttaatttgtgtgcaattg 15698697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 397 - 470
Target Start/End: Complemental strand, 45749536 - 45749466
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcatt 470  Q
    ||||||||||||| |||||||||||||| | |||||| |||| ||||||| |||||||||||||| ||| ||||    
45749536 gtttgtctttttc-ttataaagtaaggg-cggtttagtaaaa-gtgttatgtctaatgattattttattccatt 45749466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 1e-21; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 342 - 479
Target Start/End: Complemental strand, 33056374 - 33056242
Alignment:
342 caactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagt 441  Q
    |||||||| |||||||||| ||||| ||| ||| |||||| |||||  ||| ||  |||||||||||| | |||||||||||| |||||||| |||| ||    
33056374 caactttatcctctccaac-ttttctctcacacaattttcaatgcagttttaaa--tttgtctttttcttaataaagtaaggg-cagtttagtaaaa-gt 33056280  T
442 gttatatctaatgattatttcatttcattccttaatct 479  Q
    ||||| | ||||||||||||||||||||||||||||||    
33056279 gttatgtttaatgattatttcatttcattccttaatct 33056242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 340 - 478
Target Start/End: Complemental strand, 22627445 - 22627313
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||||||||||||| ||||| ||| ||| |||||| |||||||||| |  ||||||||| ||  ||||||||||| || |||||||| |||      
22627445 tccaactttaccctctccaac-ttttctctcacacaattttcaatgcaactttaa--gtttgtcttatt-tttataaagtaaagg-cagtttagtaaat- 22627352  T
440 gtgttatatctaatgattatttcatttcattccttaatc 478  Q
    ||||||| | ||| |||||||||||||||||||||||||    
22627351 gtgttatgtttaacgattatttcatttcattccttaatc 22627313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 361 - 480
Target Start/End: Complemental strand, 34002204 - 34002089
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |   |||||||||||| ||||||||||| | ||||||||| |||  |||||||||| ||||||||||    
34002204 cttttctctcacacaattttcaatgcaactttaat--tttgtctttttc-ttataaagtaaagtgcagtttagcaaag-gtgttatatccaatgattatt 34002109  T
461 tcatttcattccttaatctg 480  Q
    |||||||||| |||||||||    
34002108 tcatttcatttcttaatctg 34002089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 313 - 477
Target Start/End: Complemental strand, 28044259 - 28044101
Alignment:
313 ttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcntt 412  Q
    ||||||||||||||||||       | |||||||||| |||||||||  ||||| ||| ||| |||||| || ||||||| |   |||||||||||| ||    
28044259 ttttcaatacaactttaatttttttcttccaactttatcctctccaat-ttttctctcacacaattttcaatacaactttaat--tttgtctttttc-tt 28044164  T
413 ataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    |||||||||||| |||||||| |||||  |||||||| |||||||||||||||| ||| ||||||    
28044163 ataaagtaaggg-cagtttagtaaaaac-gttatatccaatgattatttcattttatttcttaat 28044101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 17869389 - 17869443
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||||||||||||||||||||||||||||||||  ||||||||    
17869389 aaaagtgttatgtctaatgattatttcatttcattccttaatctgtgtgcaattg 17869443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 372 - 475
Target Start/End: Original strand, 34733402 - 34733500
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| |  ||||||||||||| ||||||||||||||  ||||||| |||| ||||||| |||||||||||||||||||||||     
34733402 cacaattttcaatgcaactttaa--gtttgtctttttc-ttataaagtaagggt-agtttagtaaaa-gtgttatgtctaatgattatttcatttcattt 34733496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 340 - 490
Target Start/End: Original strand, 42121604 - 42121748
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||| |||||||| |||||| |||  || |||||| ||||||||||  | || | |||||||| | ||||||||| || ||||||| | ||||    
42121604 tccaactttactctctccaa-cttttctctcaaacaattttcaatgcaacttt--aagtgtatctttttc-taataaagtaa-ggtcagttta-gtaaaa 42121697  T
440 gtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||| ||| |||||||||||||| ||||||||||||||||||  ||||||||    
42121698 gtgatatgtctaatgattatttgatttcattccttaatctgtgtgcaattg 42121748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 436 - 490
Target Start/End: Complemental strand, 19920284 - 19920230
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    |||||||| || |||||||||||||||||||||||||||||| || |||||||||    
19920284 aaaagtgtcatgtctaatgattatttcatttcattccttaatttgtatgcaattg 19920230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 398 - 480
Target Start/End: Complemental strand, 41905971 - 41905892
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    |||||||||||| |||||||||||||| |||||||| |||| | |||||||| ||||||||||||| |||||| |||||||||    
41905971 tttgtctttttc-ttataaagtaaggg-cagtttagtaaaa-gcgttatatccaatgattatttcagttcatttcttaatctg 41905892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 405 - 480
Target Start/End: Original strand, 18886768 - 18886841
Alignment:
405 ttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    ||||| |||||||||||||| |||||||| |||| | |||||||||||||||||||||||| |||| |||| ||||    
18886768 ttttccttataaagtaaggg-cagtttagtaaaa-gcgttatatctaatgattatttcattccatttcttagtctg 18886841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 340 - 490
Target Start/End: Original strand, 32275257 - 32275401
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||||||||| ||| |||||  || ||| |||||| |||||||||| |  |||||  |||||| ||||||||||| || |||||||| |||||    
32275257 tccaactttaccctctcaaac-ttttccttcacacaattttcaatgcaactttaa--gtttgattttttc-ttataaagtaaagg-cagtttagtaaaaa 32275351  T
440 gtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
      || || | ||||||||||||||||||||| |||||| ||  ||||||||    
32275352 c-gtcatgtttaatgattatttcatttcatttcttaatatgtgtgcaattg 32275401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 361 - 490
Target Start/End: Complemental strand, 48838756 - 48838627
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcn----ttataaagtaaggggcagtttaggaaaaagtgttatatctaatgat 456  Q
    |||||| ||| ||| |||||| |||||||||| ||  |||||||||||      |||||||||||||  |||||||| | ||| |||||| |||||||||    
48838756 cttttctctcacacaattttcaatgcaactttaaa--tttgtctttttttatttttataaagtaaggt-cagtttagtataaa-tgttatgtctaatgat 48838661  T
457 tatttcatttcattccttaatctggatgcaattg 490  Q
    |||||||||| |||||||||| ||  ||||||||    
48838660 tatttcattttattccttaatttgtgtgcaattg 48838627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 423 - 490
Target Start/End: Original strand, 40298978 - 40299044
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||| ||||||| || ||| ||||||||||||||||||||||| ||  ||||||||    
40298978 gggcagtttagtaaaa-gtgttatgtccaattattatttcatttcattccttaatttgtgtgcaattg 40299044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 399 - 478
Target Start/End: Complemental strand, 42259584 - 42259508
Alignment:
399 ttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatc 478  Q
    ||||||||||| |||||||||||||| || ||||| |||| ||||||| |||||| ||||| ||||||||||| ||||||    
42259584 ttgtctttttc-ttataaagtaaggg-cattttagtaaaa-gtgttatgtctaataattatctcatttcattctttaatc 42259508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 398 - 480
Target Start/End: Complemental strand, 3680959 - 3680880
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    |||||||||||| |||||||||||| | |||||||| |||| || |||| |||||||||||||||||| ||||  ||||||||    
3680959 tttgtctttttc-ttataaagtaagag-cagtttagtaaaa-gttttatgtctaatgattatttcattccattttttaatctg 3680880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 6e-21; HSPs: 16)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 313 - 477
Target Start/End: Complemental strand, 40987398 - 40987242
Alignment:
313 ttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcntt 412  Q
    ||||||||||||||||||       | ||||||||||||||||||||| |||   ||| ||| |||||| |||||||||| ||  ||| |||||||| ||    
40987398 ttttcaatacaactttaatttttttcttccaactttaccctctccaactttt---ctctcacaattttcaatgcaactttaaa--tttatctttttc-tt 40987305  T
413 ataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    |||||||||||  || ||||| |||| ||||||| ||||||||||||||||||||||||||||||    
40987304 ataaagtaagga-caatttagtaaaa-gtgttatgtctaatgattatttcatttcattccttaat 40987242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 340 - 490
Target Start/End: Complemental strand, 29795290 - 29795146
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||||||||||||| |||||  || ||| |||||| |||||||||| ||   ||||||||||| ||||||| |||||| |||||||| ||||     
29795290 tccaactttaccctctccaac-ttttctttcacacaattttcaatgcaactttaaag--ttgtctttttc-ttataaaataaggg-cagtttagtaaaa- 29795197  T
440 gtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    || |||| |||||||||||||||||| ||||| ||||||||  ||||||||    
29795196 gtattatgtctaatgattatttcattccattcattaatctgcgtgcaattg 29795146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 361 - 479
Target Start/End: Original strand, 34225831 - 34225944
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |  ||||||||||||| |||||||||||||| || ||||| ||||  | |||| |||||||||||||    
34225831 cttttctctcacacaattttcaatgcaactttaa--gtttgtctttttc-ttataaagtaaggg-caatttagtaaaat-tattatgtctaatgattatt 34225925  T
461 tcatttcattccttaatct 479  Q
    |||||||||||||||||||    
34225926 tcatttcattccttaatct 34225944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 361 - 480
Target Start/End: Original strand, 7743482 - 7743596
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| ||  |||||||||||| |||||||||||||| ||  |||| |||| ||||||||||| |||||||||    
7743482 cttttctctcacacaattttcaatgcaactttaaa--tttgtctttttc-ttataaagtaaggg-caacttagtaaaa-gtgttatatctgatgattatt 7743576  T
461 tcatttcattccttaatctg 480  Q
    |||||| |||| ||||||||    
7743577 tcatttaattctttaatctg 7743596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 341 - 480
Target Start/End: Original strand, 40410505 - 40410638
Alignment:
341 ccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaag 440  Q
    ||||||||||||||||||| |||||| ||  ||| |||||| ||||||||||  |  |||||||||||| ||||||||||| ||||||||||   |||||    
40410505 ccaactttaccctctccaa-cttttctctgacacaattttcaatgcaacttt--aattttgtctttttc-ttataaagtaa-gggcagttta-ataaaag 40410598  T
441 tgttatatctaatgattatttcatttcattccttaatctg 480  Q
     |||||||| ||||||||| ||||| |||| |||||||||    
40410599 cgttatatccaatgattatgtcattccatttcttaatctg 40410638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 436 - 477
Target Start/End: Original strand, 6592107 - 6592148
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
6592107 aaaagtgttatgtctaatgattatttcatttcattccttaat 6592148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 397 - 490
Target Start/End: Complemental strand, 36360412 - 36360322
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    |||| |||||||| ||||||| |||||| |||||||| |||| ||||||| |||||||||||||||||||||||| ||||| ||  ||||||||    
36360412 gtttatctttttc-ttataaaataaggg-cagtttagtaaaa-gtgttatgtctaatgattatttcatttcattctttaatttgcgtgcaattg 36360322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 398 - 477
Target Start/End: Complemental strand, 4840763 - 4840687
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    |||||||||||| |||||||||||||| |||||||| |||||  |||||||| ||||||||||||||| |||| ||||||    
4840763 tttgtctttttc-ttataaagtaaggg-cagtttagtaaaaac-gttatatccaatgattatttcattccatttcttaat 4840687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 423 - 477
Target Start/End: Original strand, 4536701 - 4536754
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| |||| ||| ||| ||||||||||||||||||||||||||||||    
4536701 gggcagtttagtaaaa-gtgatatgtctaatgattatttcatttcattccttaat 4536754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 437 - 477
Target Start/End: Original strand, 14511602 - 14511642
Alignment:
437 aaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    |||| ||||| ||||||||||||||||||||||||||||||    
14511602 aaagggttatgtctaatgattatttcatttcattccttaat 14511642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 465
Target Start/End: Complemental strand, 14378319 - 14378220
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||  |||||| |||||||||| ||  ||| |||||||| |||||||||||||| |||||||| |||| |||||||||  ||||||||||    
14378319 cttttctctcgcataattttcaatgcaactttaaa--tttatctttttc-ttataaagtaaggg-cagtttagtaaaa-gtgttatattaaatgattatt 14378225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 340 - 462
Target Start/End: Original strand, 1381802 - 1381916
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    |||||||||||| |||||||| |||   ||| ||| |||||| |||||| ||| |  |||| |||||||| |||||||||||| | |||||||| ||||     
1381802 tccaactttaccttctccaactttt---ctctcacaattttcaatgcaattttaa--gtttttctttttc-ttataaagtaagag-cagtttagtaaaa- 1381893  T
440 gtgttatatctaatgattatttc 462  Q
    ||||||| |||||||||||||||    
1381894 gtgttatgtctaatgattatttc 1381916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 24775340 - 24775394
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||||||||||||||||||||||  || ||||||| ||  ||||||||    
24775340 aaaagtgttatatctaatgattatttcattcaataccttaatttgtgtgcaattg 24775394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 470
Target Start/End: Original strand, 44228617 - 44228651
Alignment:
436 aaaagtgttatatctaatgattatttcatttcatt 470  Q
    |||||||||||||||||||||||||||||| ||||    
44228617 aaaagtgttatatctaatgattatttcattccatt 44228651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 398 - 479
Target Start/End: Complemental strand, 1298816 - 1298738
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    |||||||||||| |||||||||||||| || ||||| |||||  |||||||  |||||||||||||||| ||| ||||||||    
1298816 tttgtctttttc-ttataaagtaaggg-caatttagtaaaaac-gttatattcaatgattatttcattttatttcttaatct 1298738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 361 - 467
Target Start/End: Complemental strand, 4766283 - 4766182
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |   |||||||||||| ||||||||||| || |||||||| || ||  |||||||| ||||||||||    
4766283 cttttctctcacacaattttcaatgcaactttaat--tttgtctttttc-ttataaagtaaagg-cagtttagtaataac-gttatatccaatgattatt 4766189  T
461 tcatttc 467  Q
    |||||||    
4766188 tcatttc 4766182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 51; Significance: 9e-20; HSPs: 17)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 340 - 480
Target Start/End: Complemental strand, 14980139 - 14980008
Alignment:
340 tccaactttaccctctccaaccttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaa 439  Q
    ||||||||||||||||||||| ||||| |    || |||||| |||||||||| |   |||||||||||| |||||||||||||| |||||| || ||||    
14980139 tccaactttaccctctccaactttttctc----acaattttcaatgcaactttaat--tttgtctttttc-ttataaagtaaggg-cagttt-ggtaaaa 14980049  T
440 gtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    |||||||||| ||||||||||||||| |||| |||||||||    
14980048 gtgttatatccaatgattatttcattccatttcttaatctg 14980008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 397 - 489
Target Start/End: Original strand, 36660541 - 36660630
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaatt 489  Q
    ||||||||||||| |||||||||||||  || ||||| |||| ||||||| |||||||||||||||||||||||||||||||||  |||||||    
36660541 gtttgtctttttc-ttataaagtaagga-cattttagtaaaa-gtgttatgtctaatgattatttcatttcattccttaatctgtgtgcaatt 36660630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 372 - 490
Target Start/End: Complemental strand, 43257920 - 43257807
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| |  |||||||| |||| |||||||||||||| |||||||| | || ||||||| ||||||||||||||||||||||||    
43257920 cacaattttcaatgcaactttaa--gtttgtctatttc-ttataaagtaaggg-cagtttagtataa-gtgttatgtctaatgattatttcatttcattc 43257826  T
472 cttaatctggatgcaattg 490  Q
     ||||||||  ||||||||    
43257825 tttaatctgtgtgcaattg 43257807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 423 - 490
Target Start/End: Complemental strand, 166662 - 166596
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||  ||||||||    
166662 gggcagtttagtaaaa-gtgttatttctaatgattatttcatttcattccttaatctgtgtgcaattg 166596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 12992205 - 12992259
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||||||||||||||||||||||||||||| || |||||||||    
12992205 aaaagtgttatgtctaatgattatttcatttcattccttaatttgtatgcaattg 12992259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 436 - 479
Target Start/End: Complemental strand, 24436541 - 24436498
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    ||||||||||||||||||||||||||||||| ||||||||||||    
24436541 aaaagtgttatatctaatgattatttcattttattccttaatct 24436498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 436 - 490
Target Start/End: Complemental strand, 4751531 - 4751477
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||||||||||||||||||||||||||||| ||  ||||||||    
4751531 aaaagtgttatgtctaatgattatttcatttcattccttaatatgtgtgcaattg 4751477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 13066856 - 13066910
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||| | |||||||||||||||||||||||||||||| || |||||||||    
13066856 aaaagtgttgtgtctaatgattatttcatttcattccttaatttgtatgcaattg 13066910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 361 - 490
Target Start/End: Original strand, 36783437 - 36783561
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| ||  |||||||||||| | | || ||||||| || ||||| ||||| |||||| |||||||||||||    
36783437 cttttctctcacacaattttcaatgcaactttaaa--tttgtctttttcataacaa-gtaaggg-caatttagtaaaaa-tgttatgtctaatgattatt 36783531  T
461 tcatttcattccttaatctggatgcaattg 490  Q
    |||||||||  |||||||||  ||||||||    
36783532 tcatttcatctcttaatctgtgtgcaattg 36783561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 398 - 480
Target Start/End: Complemental strand, 4967527 - 4967448
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    |||||||||||  |||||||||||||| |||||||| |||| | |||||||| ||||||||||||||| |||| |||||||||    
4967527 tttgtcttttt-tttataaagtaaggg-cagtttagtaaaa-gcgttatatccaatgattatttcattccatttcttaatctg 4967448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 342 - 465
Target Start/End: Complemental strand, 12167700 - 12167582
Alignment:
342 caactttaccctctccaaccttttcnctcccacna-ttttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaag 440  Q
    ||||||||||||||||||| ||||| ||| ||| | ||||| |||||||||| |  ||||| | ||||| |||||||||||||| |||||||| |||| |    
12167700 caactttaccctctccaac-ttttctctcacacaaattttcaatgcaactttaa--gtttgaccttttc-ttataaagtaaggg-cagtttagtaaaa-g 12167607  T
441 tgttatatctaatgattatttcatt 465  Q
    |||| | ||||||||||||||||||    
12167606 tgttttgtctaatgattatttcatt 12167582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 397 - 480
Target Start/End: Original strand, 34919851 - 34919931
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    ||||||||||||| |||||||||||||| |||||||| ||||  || ||| || ||||||||||| ||||||||||||||||||    
34919851 gtttgtctttttc-ttataaagtaaggg-cagtttagtaaaat-tgctatgtccaatgattattttatttcattccttaatctg 34919931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 436 - 490
Target Start/End: Complemental strand, 4742267 - 4742213
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| ||| |||||||||||||||||||||||||| ||  ||||||||    
4742267 aaaagtgttatgtctgatgattatttcatttcattccttaatatgtgtgcaattg 4742213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 361 - 480
Target Start/End: Original strand, 31889801 - 31889915
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |   |||||||||||| |||||||||||||| ||||||||  ||||  |||||||  ||| ||||||    
31889801 cttttctctcacacaattttcaatgcaactttaat--tttgtctttttc-ttataaagtaaggg-cagtttagtgaaaac-gttatattcaataattatt 31889895  T
461 tcatttcattccttaatctg 480  Q
    ||||| |||| |||||||||    
31889896 tcattccatttcttaatctg 31889915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 436 - 477
Target Start/End: Original strand, 4371502 - 4371543
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||| ||| |||||||||||||||||| |||||||||||    
4371502 aaaagtgctatgtctaatgattatttcattccattccttaat 4371543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 313 - 392
Target Start/End: Original strand, 16886111 - 16886189
Alignment:
313 ttttcaatacaactttaannnnnnncntccaactttaccctctccaaccttttcnctcccacnattttccatgcaacttt 392  Q
    ||||||||||||||||||       | |||||||||||||||||||| ||||||  || ||| |||||| ||||||||||    
16886111 ttttcaatacaactttaatttttttcttccaactttaccctctccaa-cttttctatcacacaattttcaatgcaacttt 16886189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 411 - 480
Target Start/End: Original strand, 16886198 - 16886265
Alignment:
411 ttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    |||||||||||||| |||||||| |||  ||||||  |||||| |||||||||||||||||||| |||||    
16886198 ttataaagtaaggg-cagtttagtaaat-gtgttacgtctaataattatttcatttcattccttgatctg 16886265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 49; Significance: 1e-18; HSPs: 7)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 361 - 490
Target Start/End: Complemental strand, 12828752 - 12828628
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| | |  ||||||||||| |||||||||||||| |||||||| |||| ||||||| |||||||||||||    
12828752 cttttctctcacacaattttcaatgcaactttaagc--ttgtctttttc-ttataaagtaaggg-cagtttagtaaaa-gtgttatgtctaatgattatt 12828658  T
461 tcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| ||||| ||  ||||||||    
12828657 tcatttcattcattaatttgtgtgcaattg 12828628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 397 - 477
Target Start/End: Complemental strand, 34439446 - 34439368
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||||| ||||||| ||| ||||| ||||  ||||| |||||||||||||||||||||||||||||| ||||||    
34439446 gtttgtctttttc-ttataaaataaagggcaatttaataaaaa-tgttatatctaatgattatttcatttcatttcttaat 34439368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 372 - 477
Target Start/End: Complemental strand, 23936644 - 23936543
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| ||  ||||| |||||| ||||||||||| ||||| || || ||||| ||||||||||||||||||||||||| ||||     
23936644 cacaattttcaatgcaactttaaa--tttgtttttttc-ttataaagtaaagggcaattcagtaaaaa-tgttatatctaatgattatttcattccattt 23936549  T
472 cttaat 477  Q
    ||||||    
23936548 cttaat 23936543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 436 - 477
Target Start/End: Original strand, 30627233 - 30627274
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    |||||||||||||||||||||||||||||||||||| |||||    
30627233 aaaagtgttatatctaatgattatttcatttcattcattaat 30627274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 361 - 465
Target Start/End: Original strand, 29915623 - 29915723
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||| | ||||||||||  | ||||||||||||| |||||||||||  |||||||||| |||| ||||||| |||||| ||||||    
29915623 cttttctctcacacaatttccaatgcaacttt--atgtttgtctttttc-ttataaagtaaatggcagtttagtaaaa-gtgttatttctaattattatt 29915718  T
461 tcatt 465  Q
    |||||    
29915719 tcatt 29915723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 8052486 - 8052540
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| ||||||||||||||||||||||| |||||| ||  ||||||||    
8052486 aaaagtgttatgtctaatgattatttcatttcatttcttaatttgtgtgcaattg 8052540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 372 - 490
Target Start/End: Complemental strand, 31275701 - 31275588
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| |  ||||||||||||| | |||||  ||||| |||||| || ||||||||||  ||||||| |||||||||||| |||    
31275701 cacaattttcaatgcaactttaa--gtttgtctttttcat-ataaaacaaggg-cagttt-ggtaaaagtgttacgtctaatggttatttcatttctttc 31275607  T
472 cttaatctggatgcaattg 490  Q
    |||||||||  ||||||||    
31275606 cttaatctgtgtgcaattg 31275588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 14)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 372 - 490
Target Start/End: Complemental strand, 38329114 - 38329002
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| |  |||||||||||   |||||||||||||  |||||||| |||| ||||||| |||||||||||||||||| |||||    
38329114 cacaattttcaatgcaactttaa--gtttgtcttttg-attataaagtaagg--cagtttagtaaaa-gtgttatgtctaatgattatttcattccattc 38329021  T
472 cttaatctggatgcaattg 490  Q
    |||||||||  ||||||||    
38329020 cttaatctgtgtgcaattg 38329002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 372 - 490
Target Start/End: Complemental strand, 32326785 - 32326672
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| ||  |||||||||||| | |||||  ||||| |||||||| |||| ||||||  ||||||||||||||||||||||||    
32326785 cacaattttcaatgcaactttaaa--tttgtctttttcat-ataaaacaaggg-cagtttagtaaaa-gtgttacgtctaatgattatttcatttcattc 32326691  T
472 cttaatctggatgcaattg 490  Q
    |||||||||  ||||||||    
32326690 cttaatctgtgtgcaattg 32326672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 372 - 490
Target Start/End: Original strand, 36915457 - 36915570
Alignment:
372 cacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattc 471  Q
    ||| |||||| |||||||||| |  ||||||||||||| | |||||  ||||| || ||||| ||||| | |||| |||||||||||||||||| |||||    
36915457 cacaattttcaatgcaactttaa--gtttgtctttttcat-ataaaacaaggg-caatttagtaaaaa-tattatgtctaatgattatttcattccattc 36915551  T
472 cttaatctggatgcaattg 490  Q
    ||||||||| |||||||||    
36915552 cttaatctgtatgcaattg 36915570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 361 - 480
Target Start/End: Original strand, 7612579 - 7612692
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||||| |||||||||| |   |||||||||||| |||||||||||||| |||||||| |||  | |||||||| ||||||||||    
7612579 cttttctctcacacaattttcaatgcaactttaat--tttgtctttttc-ttataaagtaaggg-cagtttagtaaa--gcgttatatccaatgattatt 7612672  T
461 tcatttcattccttaatctg 480  Q
    |||||  ||| |||||||||    
7612673 tcattctatttcttaatctg 7612692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 436 - 477
Target Start/End: Original strand, 156371 - 156412
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| ||||||||||||||||||||| ||||||||    
156371 aaaagtgttatgtctaatgattatttcatttcaatccttaat 156412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 436 - 477
Target Start/End: Original strand, 41414983 - 41415024
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||  ||||||||||||||||||||||||||||||    
41414983 aaaagtgttacgtctaatgattatttcatttcattccttaat 41415024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 405 - 479
Target Start/End: Original strand, 2067822 - 2067894
Alignment:
405 ttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    ||||| |||||||||||||| |||||||  |||| | |||||||| ||||||||||||||| |||| ||||||||    
2067822 ttttccttataaagtaaggg-cagtttaataaaa-gcgttatatcaaatgattatttcattccatttcttaatct 2067894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 423 - 490
Target Start/End: Original strand, 2812915 - 2812981
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||| ||||||| ||||||||||||||||||  ||| |||||| || |||||||||    
2812915 gggcagtttagtaaaa-gtgttatgtctaatgattatttcattcaattacttaatttgtatgcaattg 2812981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 397 - 480
Target Start/End: Original strand, 6839322 - 6839402
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    ||||||||||||| ||||||||||| || || ||||| |||| ||||||| |||||||||||||||||| ||||  ||||||||    
6839322 gtttgtctttttc-ttataaagtaaagg-caatttagtaaaa-gtgttatgtctaatgattatttcattccattttttaatctg 6839402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 465
Target Start/End: Complemental strand, 27109892 - 27109792
Alignment:
361 cttttcnctcccacnattttccatgcaactttcaacgtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatt 460  Q
    |||||| ||| ||| |||| | |||||||||| |  ||||||| ||||| |||||||||||  | || ||||| |||| |||||||||||||||||||||    
27109892 cttttctctcacacaatttccaatgcaactttaa--gtttgtccttttc-ttataaagtaaaagacaatttagtaaaa-gtgttatatctaatgattatt 27109797  T
461 tcatt 465  Q
    |||||    
27109796 tcatt 27109792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 397 - 480
Target Start/End: Original strand, 32737880 - 32737960
Alignment:
397 gtttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatctg 480  Q
    |||| |||||||| ||||||||||| ||||||||||  |||| |||||||||||||||| |||||||||  ||| |||||||||    
32737880 gtttttctttttc-ttataaagtaaagggcagtttaacaaaa-gtgttatatctaatga-tatttcattcaatttcttaatctg 32737960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 490
Target Start/End: Complemental strand, 8106889 - 8106835
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||| ||| |||||||||||||||||||||||| ||||| ||  ||||||||    
8106889 aaaagtgctatgtctaatgattatttcatttcattctttaatttgtgtgcaattg 8106835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 423 - 477
Target Start/End: Original strand, 39970455 - 39970508
Alignment:
423 gggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaat 477  Q
    ||||||||||| |||| ||| ||| |||||||||||||||||||||||| |||||    
39970455 gggcagtttagtaaaa-gtggtatgtctaatgattatttcatttcattctttaat 39970508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 436 - 490
Target Start/End: Complemental strand, 45187297 - 45187243
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    |||||||| || ||||||||||||||||||  |||||||||||||  ||||||||    
45187297 aaaagtgtcatgtctaatgattatttcattatattccttaatctgtgtgcaattg 45187243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0580 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0580
Description:

Target: scaffold0580; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 398 - 479
Target Start/End: Original strand, 1690 - 1768
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    |||||||||||| |||||||||||||  |||||||| ||||| ||||||||| |||||||||||||||||||| ||||||||    
1690 tttgtctttttc-ttataaagtaaggt-cagtttagtaaaaa-tgttatatccaatgattatttcatttcatttcttaatct 1768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0580; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 398 - 479
Target Start/End: Original strand, 9429 - 9507
Alignment:
398 tttgtctttttcnttataaagtaaggggcagtttaggaaaaagtgttatatctaatgattatttcatttcattccttaatct 479  Q
    |||||||||||| |||||||||||||  |||||||| ||||| ||||||||| |||||||||||||||||||| ||||||||    
9429 tttgtctttttc-ttataaagtaaggt-cagtttagtaaaaa-tgttatatccaatgattatttcatttcatttcttaatct 9507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0189 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0189
Description:

Target: scaffold0189; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 436 - 489
Target Start/End: Complemental strand, 13069 - 13016
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaatt 489  Q
    ||||||||||| |||||||||||||||||||||||||||||||||  |||||||    
13069 aaaagtgttatgtctaatgattatttcatttcattccttaatctgtgtgcaatt 13016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 436 - 490
Target Start/End: Original strand, 31695 - 31749
Alignment:
436 aaaagtgttatatctaatgattatttcatttcattccttaatctggatgcaattg 490  Q
    ||||||||||| |||||||||||||||||||||||| ||||| ||  ||||||||    
31695 aaaagtgttatctctaatgattatttcatttcattcgttaatttgtgtgcaattg 31749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310338 times since January 2019
Visitors: 444