View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-1-9 (Length: 578)

Name: J5-1-9
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-1-9
J5-1-9
[»] chr8 (18 HSPs)
chr8 (1-489)||(4681840-4682323)
chr8 (84-433)||(4996924-4997270)
chr8 (84-421)||(4689501-4689836)
chr8 (84-422)||(4737274-4737607)
chr8 (83-422)||(4716045-4716379)
chr8 (84-420)||(10447863-10448188)
chr8 (84-421)||(4775823-4776157)
chr8 (83-420)||(4900350-4900690)
chr8 (85-422)||(4704011-4704359)
chr8 (91-422)||(4726725-4727050)
chr8 (84-420)||(4912756-4913093)
chr8 (83-419)||(21438697-21439039)
chr8 (84-342)||(4746053-4746310)
chr8 (84-258)||(4889458-4889632)
chr8 (83-261)||(4923567-4923745)
chr8 (308-422)||(4889266-4889379)
chr8 (90-400)||(4874553-4874870)
chr8 (308-423)||(4923165-4923279)


Alignment Details
Target: chr8 (Bit Score: 409; Significance: 0; HSPs: 18)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 409; E-Value: 0
Query Start/End: Original strand, 1 - 489
Target Start/End: Original strand, 4681840 - 4682323
Alignment:
1 aatatagtatatgactcttagtgtcacttctggtgtaaagtaatgtgcaaattggcttgaagtctttttgaacaannnnnnngaatacgaaatactagtt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||    
4681840 aatatagtatatgactcttagtgtcacttctggtgtaaagtaatgtgcaaattggcttgaagtctttttgaacaatttttttgaatacgaaatactagtt 4681939  T
101 gatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtgggaaggcctaaactgca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4681940 gatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtgggaaggcctaaactgca 4682039  T
201 gtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaacttcaagtatcctctaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4682040 gtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaacttcaagtatcctctaa 4682139  T
301 tgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagctcactatgttacagtactt 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
4682140 tgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagctcactatgttacagtac-t 4682238  T
401 tgggagttcctaatctcatttgggttaaatgataaaacccnaatctaaattattttccttccaggggatttnttanagattcnaaattg 489  Q
    || |||||||||||||||||| ||||||||||||||| || |||||||||||||||| |||   ||||||| ||| |||||| ||||||    
4682239 tgtgagttcctaatctcattt-ggttaaatgataaaa-ccaaatctaaattattttctttc--agggatttattagagattcaaaattg 4682323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 84 - 433
Target Start/End: Original strand, 4996924 - 4997270
Alignment:
84 aatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtg 183  Q
    ||||| ||||||||||||||||||| | ||||||||||||  | ||||||||||||||||||||||| |||||||||||||  || || || ||||||||    
4996924 aatactaaatactagttgatactatcataaacatcaagaacacttatggggtggctagaaattggcaaggagatccatgtgcccctgtgaattatatgtg 4997023  T
184 ggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaa 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||| ||||||||||||||||||||    
4997024 ggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaggtttataattccttaaataaaccatatgcataaattcaaaaa 4997123  T
284 cttcaagtatcctctaatgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagctc 383  Q
    ||| || |||||||| |  |  |||||||||||||||  ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||    
4997124 cttgaattatcctctgaaat--tatatatttggaaatgaaaccaggaatttgtcttcaagtggattgacaggggagatatcatcttctatatcaaagctc 4997221  T
384 actatgttacagtactttgggagttcctaatctcatttgggttaaatgat 433  Q
     |||||||||||||| ||| |||||||||||||||||||| | |||||||    
4997222 tctatgttacagtac-ttgtgagttcctaatctcatttggttaaaatgat 4997270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 193; E-Value: 1e-104
Query Start/End: Original strand, 84 - 421
Target Start/End: Original strand, 4689501 - 4689836
Alignment:
84 aatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtg 183  Q
    ||||| ||||||||||||||||||| | |||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||| || || ||||||||    
4689501 aataccaaatactagttgatactattacaaacattaagaaggcctatggagtggctagaaattggcaaggagatccatgtggtcctgtgaattatatgtg 4689600  T
184 ggaaggcctaaactgcagtcttgatgg---caataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaa 280  Q
    |||||||||||| || ||| ||||||    |||||||  |||||||||||||||||||||||||||||||| ||| |||||| ||||   ||||||||||    
4689601 ggaaggcctaaattgtagtattgatgatgccaataaccccccaagaatcacatctttgtaagtttacaatcacttcaataaaccata---ataaattcaa 4689697  T
281 aaacttcaagtatcctctaatgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaag 380  Q
    ||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||    
4689698 aaacttcaa-taacctctaatgttatatatatttggaaatgcaaccaggaatttgtcttcaagtggattgacaggggagatagcatctttcatatcaaag 4689796  T
381 ctcactatgttacagtactttgggagttcctaatctcattt 421  Q
    ||| |||||||| ||||| ||| ||||||||||||||||||    
4689797 ctcgctatgttagagtac-ttgtgagttcctaatctcattt 4689836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 182; E-Value: 4e-98
Query Start/End: Original strand, 84 - 422
Target Start/End: Original strand, 4737274 - 4737607
Alignment:
84 aatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtg 183  Q
    ||||| |||||| |||||||||||||| |||||||||||| || ||||| ||||| ||||||||||| |||||||||||||  || || || || |||||    
4737274 aatactaaataccagttgatactatgacaaacatcaagaatgcttatggtgtggcaagaaattggcaaggagatccatgtgcccctgtgaattacatgtg 4737373  T
184 ggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaa 283  Q
    ||||||||||||||| |||  ||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||    
4737374 ggaaggcctaaactgtagtagtgatggcaataacattccaagaatcacatctttgtaagtttataattccttaaataaaccatatgcataaattcaaaaa 4737473  T
284 cttcaagtatcctctaatgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagctc 383  Q
    |||||| |||||||| | ||    | ||||||||||   ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
4737474 cttcaattatcctctgaagt----tttatttggaaactgaaccaggaatttgtcttcaagtggattgacaggggagatatcatcttccatatcaaagctc 4737569  T
384 actatgttacagtactttgggagttcctaatctcatttg 422  Q
    |||||||| || ||| ||| |||||||||||| ||||||    
4737570 actatgttgcaatac-ttgtgagttcctaatcccatttg 4737607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 170; E-Value: 6e-91
Query Start/End: Original strand, 83 - 422
Target Start/End: Original strand, 4716045 - 4716379
Alignment:
83 gaatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgt 182  Q
    |||||| ||||||||||||||||||| | ||||||||||||  | ||||||||| ||||||||||||| ||||||||||||||||| || || |||||||    
4716045 gaatacaaaatactagttgatactatcacaaacatcaagaatacttatggggtgactagaaattggcaaggagatccatgtggtcctgtgaattatatgt 4716144  T
183 gggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatccct---taaataaatcatatgcataaattca 279  Q
    ||||||||||||| || ||| |||||||| ||| ||||||||||||||||||| ||||||||||||||||||   |||||||| ||||||||||| ||||    
4716145 gggaaggcctaaattgtagtattgatggctatagcatcccaagaatcacatctctgtaagtttacaatcccttaataaataaaccatatgcataacttca 4716244  T
280 aaaacttcaagtatcctctaatgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaa 379  Q
    |||||||    ||||||||||    |  ||||||||||||| |||||||||||||| ||||||||||||||||||| |||||| |||||||||| |||||    
4716245 aaaactt---ttatcctctaa----aattatatttggaaatgcaaccaggaatttggcttcaagtggattgacaggggagataccatcttccatctcaaa 4716337  T
380 gctcactatgttacagtactttgggagttcctaatctcatttg 422  Q
    ||||||||||||| ||||| ||| ||||| |||||||||||||    
4716338 gctcactatgttagagtac-ttgtgagtttctaatctcatttg 4716379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 84 - 420
Target Start/End: Original strand, 10447863 - 10448188
Alignment:
84 aatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtg 183  Q
    ||||| ||||||||||||||||||| | |||||||||||| || |||||| |||||||||||||| | |||||||||||||||||||| || ||||||||    
10447863 aataccaaatactagttgatactatcacaaacatcaagaatgcttatgggatggctagaaattggaatggagatccatgtggtccagtgaagtatatgtg 10447962  T
184 ggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaa 283  Q
    ||||||||||||||| ||| |||||||||||||||| | |||||||||||||||||||||||| |||| ||||||      |||| ||||||||||||||    
10447963 ggaaggcctaaactgtagtattgatggcaataacattcaaagaatcacatctttgtaagtttagaatcacttaaa------atatacataaattcaaaaa 10448056  T
284 cttcaagtatcctctaatgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagctc 383  Q
    ||| || | |||||| |    |  |||||||| |||| ||| ||||||||||||||||||||||||||| ||  ||||| || |||||||||||||||||    
10448057 ctttaattgtcctctga----aattatatttgaaaatgcaatcaggaatttgtcttcaagtggattgactggtcagatagcaccttccatatcaaagctc 10448152  T
384 actatgttacagtactttgggagttcctaatctcatt 420  Q
    |||||||||||||| |||| |||||||||||||||||    
10448153 actatgttacagta-tttgtgagttcctaatctcatt 10448188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 84 - 421
Target Start/End: Complemental strand, 4776157 - 4775823
Alignment:
84 aatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtg 183  Q
    ||||| ||||||||||||||| ||| | |||||||||||| || ||||| ||| ||||||||||||| |||||||||||||  || || || ||||||||    
4776157 aatacaaaatactagttgataatatcacaaacatcaagaatgcttatggagtgactagaaattggcaaggagatccatgtgcccctgtgaattatatgtg 4776058  T
184 ggaaggcctaaactgcag---tcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaatt-ca 279  Q
    ||||||||||||||| ||   |  ||||| ||||||   |||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||    
4776057 ggaaggcctaaactgtagcactgatgatgacaataatcccccaagaatcacatctttgtaagtttacaatcccttaaattaaccatatgcataaatttca 4775958  T
280 aaaacttcaagtatcctctaatgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaa 379  Q
    ||||||| || |||||||| |  ||||      ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4775957 aaaactttaattatcctctgaaattat------ttggaaacacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaa 4775864  T
380 gctcactatgttacagtactttgggagttcctaatctcattt 421  Q
    ||| ||||||||||| ||| ||| ||||||||||||| ||||    
4775863 gctaactatgttacaatac-ttgtgagttcctaatcttattt 4775823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 83 - 420
Target Start/End: Complemental strand, 4900690 - 4900350
Alignment:
83 gaatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgt 182  Q
    |||||| |||| |||||||||||||| | |||||||||| | || ||||||||||||||||||||||| ||||||||||||||||| || || |||||||    
4900690 gaataccaaatgctagttgatactatcacaaacatcaaggatgcttatggggtggctagaaattggcaaggagatccatgtggtcctgtgaaatatatgt 4900591  T
183 gggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaa 282  Q
    |||||| ||||||||| ||| |||||||| ||| ||| |||||||||||||||||||||||||||||| |||||||||||   ||||||||| |||||||    
4900590 gggaagtcctaaactgtagtattgatggctatagcattccaagaatcacatctttgtaagtttacaattccttaaataaactgtatgcataacttcaaaa 4900491  T
283 acttcaagtatcctct-aatgttatatatatttggaaat----acaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatca 377  Q
    ||||||| | | |||| | ||  | | || |||| ||||     |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||     
4900490 acttcaattgtgctctgactgaaaga-atgtttgaaaatggaaccaaccagggatttgtcttcaagtggattgacaggggagatatcatcttccatatcg 4900392  T
378 aagctcactatgttacagtactttgggagttcctaatctcatt 420  Q
    ||||||||||||||||||||| |||  ||||||||||||||||    
4900391 aagctcactatgttacagtac-ttgtaagttcctaatctcatt 4900350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 85 - 422
Target Start/End: Original strand, 4704011 - 4704359
Alignment:
85 atacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtgg 184  Q
    |||||||||||||||||||||||| |  || ||||||||  | ||||||||| ||||||||||||| |||||||||||||  || || || || ||||||    
4704011 atacgaaatactagttgatactatcatgaatatcaagaacacttatggggtgtctagaaattggcaaggagatccatgtgtccctgtgaattacatgtgg 4704110  T
185 gaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaac 284  Q
    |||||| ||||||| | | |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||    
4704111 gaaggcgtaaactgtactattgatgccaatagcatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatccataaattcaagaac 4704210  T
285 ttcaagtatcctctaatgttatata------------tatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttcca 372  Q
    ||||| |||| | | |||||| |||            ||||| |||||  |||||||||||||||||||||||| |||||||| ||||||||||||||||    
4704211 ttcaattatcatttgatgttaaatatatccctgaaattattttgaaatgaaaccaggaatttgtcttcaagtgggttgacaggggagatatcatcttcca 4704310  T
373 tatcaaagctcactatgttacagtactttgggagttcctaatctcatttg 422  Q
    ||| |||| |||| || ||||||||| ||| |||||||||||||||||||    
4704311 tattaaagttcaccatattacagtac-ttgtgagttcctaatctcatttg 4704359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 91 - 422
Target Start/End: Original strand, 4726725 - 4727050
Alignment:
91 aatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtgggaaggc 190  Q
    ||||| |||||||||||||| |||||||||||| || ||||||||| |||| |||||||||||||||||||||||||| || || |||||||||||||||    
4726725 aatacaagttgatactatgacaaacatcaagaatgcttatggggtgactaggaattggcagggagatccatgtggtcccgtgaaatatatgtgggaaggc 4726824  T
191 ctaaactgcagtcttgatggc---aataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaacttc 287  Q
     ||||||||||| |||||||    ||||||  |  |||||||| || |||||||||||| ||  ||    ||||| ||||||||||||||| |||||||     
4726825 ttaaactgcagtattgatggtggaaataaccccaaaagaatcatatatttgtaagtttataaaacc----ataaaccatatgcataaattccaaaacttt 4726920  T
288 aagtatcctctaatgttatatatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagctcacta 387  Q
    || |||||||| | ||    | ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||    
4726921 aattatcctctgaagt----tttatttggaaatgcaaccaggaatttgtcttcaagtggattgacaggggagatatcatctgccatatcaaagctcacta 4727016  T
388 tgttacagtactttgggagttcctaatctcatttg 422  Q
    |||| || ||| ||| |||||||||||| ||||||    
4727017 tgttgcaatac-ttgtgagttcctaatcccatttg 4727050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 84 - 420
Target Start/End: Complemental strand, 4913093 - 4912756
Alignment:
84 aatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtg 183  Q
    ||||| ||||| ||||| || |||| | |||||||||| | || |||| |||||||||||||||||| ||||||||||||||||| || || ||||||||    
4913093 aataccaaataatagttaatgctatcacaaacatcaaggatgcttatgtggtggctagaaattggcaaggagatccatgtggtcctgtgaattatatgtg 4912994  T
184 ggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaa 283  Q
    ||||||||||||||| ||| |||||||| ||| ||| ||||||||||||||||||||||||||| || ||||||||||| ||||  ||||||||||| ||    
4912993 ggaaggcctaaactgtagtattgatggctatagcattccaagaatcacatctttgtaagtttaccattccttaaataaaccata--cataaattcaagaa 4912896  T
284 cttcaagtatcctctaatgttata-tatatttggaaat---acaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaa 379  Q
    |||||| |||||||| |  | | | ||||| |||||||   || | |||| ||||||||||||||||||| | |||  | ||||||| ||||||||||||    
4912895 cttcaattatcctctgacttaaaagtatatatggaaatggaaccaacagggatttgtcttcaagtggattaaaagggcatatatcatattccatatcaaa 4912796  T
380 gctcactatgttacagtactttgggagttcctaatctcatt 420  Q
    |||||| || ||||| ||| ||| |||||||| ||||||||    
4912795 gctcacaatattacaatac-ttgtgagttcctcatctcatt 4912756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 83 - 419
Target Start/End: Complemental strand, 21439039 - 21438697
Alignment:
83 gaatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgt 182  Q
    |||||| |||||||||||||| |||| | |||| ||||| | || |||  |||||||||||||||||| ||||||||||||||||| |  || |||||||    
21439039 gaataccaaatactagttgatgctatcacaaacgtcaaggatgcttataaggtggctagaaattggcaaggagatccatgtggtcctgggaattatatgt 21438940  T
183 gggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcata---aattca 279  Q
    ||||||||||||| || ||  |||||||  ||| ||||||||||||||||||||||||||||||| || ||||||||||| |||||||| |   ||||||    
21438939 gggaaggcctaaattgtagcattgatggatatagcatcccaagaatcacatctttgtaagtttactattccttaaataaaccatatgcaaatataattca 21438840  T
280 aaaacttcaagtatcctctaatgttatatatatttggaaat----acaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatat 375  Q
    |||||||||| |||||||| |  | |  ||||| |||||||     |||||||||||||||||||||||||| ||| |||  | |||||||||| ||| |    
21438839 aaaacttcaattatcctctgacttaaagtatatatggaaatggaaccaaccaggaatttgtcttcaagtggactgagagggaatatatcatcttacatct 21438740  T
376 caaagctcactatgttacagtactttgggagttcctaatctcat 419  Q
    |||||||||| ||||||||  || ||| |||||||| |||||||    
21438739 caaagctcacaatgttacaaaac-ttgtgagttccttatctcat 21438697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 116; E-Value: 1e-58
Query Start/End: Original strand, 84 - 342
Target Start/End: Original strand, 4746053 - 4746310
Alignment:
84 aatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtg 183  Q
    ||||||||||||||||||||||||| | |||||||||||| || |||||||| || ||||||||||| ||||||||||||||||| ||  | |||||||     
4746053 aatacgaaatactagttgatactatcacaaacatcaagaatgcttatggggttgcgagaaattggcaaggagatccatgtggtcctgtgcagtatatgta 4746152  T
184 ggaaggcctaaactgcagtcttga---tggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattc-a 279  Q
    |||| |||||||||||||| ||||   ||| ||||||  |||||||||||||| |||||||||||| ||| |||    | || ||||||||||||||| |    
4746153 ggaatgcctaaactgcagtattgatggtggaaataaccccccaagaatcacatatttgtaagtttataattcct----tcaaccatatgcataaattcaa 4746248  T
280 aaaacttcaagtatcctctaatgttatatatatttggaaatacaaccaggaatttgtcttcaa 342  Q
    |||||||||| || ||||||||||||||||||||||||||| |||||||||||||||| ||||    
4746249 aaaacttcaa-taacctctaatgttatatatatttggaaatgcaaccaggaatttgtcgtcaa 4746310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 84 - 258
Target Start/End: Complemental strand, 4889632 - 4889458
Alignment:
84 aatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtg 183  Q
    ||||||||||||||||||||||||| | |||||||||||| || |||||| || ||||||||||| | |||||||||||||  || || || ||  ||||    
4889632 aatacgaaatactagttgatactatcacaaacatcaagaatgcttatgggctgactagaaattgggaaggagatccatgtgcccctgtgaattacgtgtg 4889533  T
184 ggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaa 258  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||||| |||||||    
4889532 ggaaggcctaaactgcagtattgatggcaataacatcccaagaatcatatctttgtaagtatacaattccttaaa 4889458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 83 - 261
Target Start/End: Complemental strand, 4923745 - 4923567
Alignment:
83 gaatacgaaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgt 182  Q
    |||||| | ||||||||||||||||| | ||||||||||||| | ||||||||||||| ||||||||| |||||||||||||| || || || ||||| |    
4923745 gaatacaatatactagttgatactatcacaaacatcaagaagacttatggggtggctaaaaattggcaaggagatccatgtggccctgtgaagtatatat 4923646  T
183 gggaaggcctaaactgcagtcttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataa 261  Q
    |||||||||||||||||||  |||||||  |||||  |||||||||||||||||||||||| ||| ||||||| |||||    
4923645 gggaaggcctaaactgcagcgttgatggatataaccccccaagaatcacatctttgtaagtctactatcccttgaataa 4923567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 308 - 422
Target Start/End: Complemental strand, 4889379 - 4889266
Alignment:
308 tatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagctcactatgttacagtactttgggagt 407  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||| ||| ||||    
4889379 tatatttggaaatgcaaccaggaatttgtcttcaagtggattgacaggggagatatcatcatccatatcaaagctcactatgttacaatac-ttgtgagt 4889281  T
408 tcctaatctcatttg 422  Q
    |||||||||||||||    
4889280 tcctaatctcatttg 4889266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 90 - 400
Target Start/End: Complemental strand, 4874870 - 4874553
Alignment:
90 aaatactagttgatactatgagaaacatcaagaaggcctatggggtggctagaaattggcagggagatccatgtggtccagtaaactatatgtgggaagg 189  Q
    ||||||||||||||||||| | |||||||||||| || ||||||||||  ||||||||||| ||||||||||||   || | |   || |||||||||||    
4874870 aaatactagttgatactatcacaaacatcaagaatgcttatggggtggaaagaaattggcaaggagatccatgttaccctgaagcatacatgtgggaagg 4874771  T
190 cctaaactgcagt---cttgatggcaataacatcccaagaatcacatctttgtaagtttacaatcccttaaataaatcatatgcataaattcaaaaactt 286  Q
    ||||||||| |||   | | ||   | |  |  ||||||||||  ||||||||||||||||||||||| ||||||| ||| | ||||||||||| ||| |    
4874770 cctaaactgtagtatgcattatctgattggcggcccaagaatcctatctttgtaagtttacaatccctgaaataaaccat-ttcataaattcaacaacct 4874672  T
287 caagtatcctctaatgttatatatatttggaaat-----acaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagc 381  Q
    ||| ||||||||||    |  |||||||| ||||      |||| |||||||||||||||  ||||||||||||  |||||||||||| ||| ||||| |    
4874671 caattatcctctaacagaaactatatttgaaaatggaacccaactaggaatttgtcttcatctggattgacagggcagatatcatctttcatctcaaatc 4874572  T
382 tcactatgttacagtactt 400  Q
    ||||||||||| |||||||    
4874571 tcactatgttagagtactt 4874553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 308 - 423
Target Start/End: Complemental strand, 4923279 - 4923165
Alignment:
308 tatatttggaaatacaaccaggaatttgtcttcaagtggattgacaggagagatatcatcttccatatcaaagctcactatgttacagtactttgggagt 407  Q
    |||||||||||||  ||||||||||||||||||||||||| | |||||  || || ||| | | |||||||||||||||||||| |||||| ||| ||||    
4923279 tatatttggaaatggaaccaggaatttgtcttcaagtggactcacagggcagttaacatatcctatatcaaagctcactatgttgcagtac-ttgtgagt 4923181  T
408 tcctaatctcatttgg 423  Q
     |||||| ||||||||    
4923180 acctaatttcatttgg 4923165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 312901 times since January 2019
Visitors: 445