View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-13_15 (Length: 919)

Name: J5-13_15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-13_15
J5-13_15
[»] chr8 (6 HSPs)
chr8 (361-919)||(34537992-34538550)
chr8 (1-368)||(34537629-34537996)
chr8 (773-882)||(34533295-34533407)
chr8 (716-766)||(38634303-38634353)
chr8 (716-753)||(39851268-39851305)
chr8 (734-767)||(38637319-38637352)


Alignment Details
Target: chr8 (Bit Score: 555; Significance: 0; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 555; E-Value: 0
Query Start/End: Original strand, 361 - 919
Target Start/End: Complemental strand, 34538550 - 34537992
Alignment:
361 aaattaataatgaacctgcgatttgtgataataacctgttatttataagttatagacactcatcaaaatgatgtgatattctgttgaaaacatgtagaga 460  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
34538550 aaattaataatgaacctgcgatttgtgataataacctgttatttataagttatagacacttatcaaaatgatgtgatattctgttgaaaacatgtagaga 34538451  T
461 ttttccatgtatttgttgaaatctgcagtgaggacagtaaagttgtaatctggaaacctaaaaattagtttattaggctgctgaagttttgatggtttga 560  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34538450 ttttccatgtatttgttgaaatctgcagtgaggacagtaaagttgtaatctggaaacctaaaaattagtttattaggctgctgaagttttgatggtttga 34538351  T
561 gcatatggttgataggaccaaaacttgcccaaagttgatggtaagattaccaactattagcttcgaaaagtaaaatttgttaactttcacacatttatct 660  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34538350 gcatatggttgataggaccaaaacttgcccaaagttgatggtaagattaccaactattagcttcgaaaagtaaaatttgttaactttcacacatttatct 34538251  T
661 atacatctatgactgagataaatagtctcaagaagttttagtctggcgtatcagctgttcaccaatgttttgtttttcctatgcagagatcatgacgatg 760  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34538250 atacatctatgactgagataaatagtctcaagaagttttagtctggcgtatcagctgttcaccaatgttttgtttttcctatgcagagatcatgacgatg 34538151  T
761 agaaagatgaagatgcacagtcaggtgtttagtttagcagtcagttgtgtttggagtctgcttttttatatttctttacatcaagtggaactttgtcatg 860  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34538150 agaaagatgaagatgcacagtcaggtgtttagtttagcagtcagttgtgtttggagtctgcttttttatatttctttacatcaagtggaactttgtcatg 34538051  T
861 cagattcaatttttggatttcactagcactactaattctcaaaacatcttaacctgttc 919  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34538050 cagattcaatttttggatttcactagcactactaattctcaaaacatcttaacctgttc 34537992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Complemental strand, 34537996 - 34537629
Alignment:
1 tgttccagtttattttgtttatcttattactcactagcacttattcacgtttgccagtgaattaaaacttcaaaatattcatcatgattcatatattaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34537996 tgttccagtttattttgtttatcttattactcactagcacttattcacgtttgccagtgaattaaaacttcaaaatattcatcatgattcatatattaag 34537897  T
101 agaagtcttctaaataaatatggatgggttggtattgaaattacatcaacaataaaaatcatctggttgtggaaaatcttgaatttgtacaaagagattg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34537896 agaagtcttctaaataaatatggatgggttggtattgaaattacatcaacaataaaaatcatctggttgtggaaaatcttgaatttgtacaaagagattg 34537797  T
201 gaacnnnnnnncttctcattctttcgctatgtttcctaaattgcctcctaaggttagaaagattgtatatgaatatgagaagggtaggaaaaagaaaaga 300  Q
    ||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
34537796 gaactttttttcttctcattctttcgctatgtttcctaaattgcctcctaaggttagaaagattgtatatgaatatgagaagtgtaggaaaaagaaaaga 34537697  T
301 attaggaggtaactcaatctcaaataggagatcttgatcaacctgctataaatcaaccacaaattaat 368  Q
    |||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||    
34537696 attaggagttaactcaatctcaaataggagatcttgatcaacttgttataaatcaaccacaaattaat 34537629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 773 - 882
Target Start/End: Complemental strand, 34533407 - 34533295
Alignment:
773 atgcacagtcaggtgtttagtttagcagtcagttgtgtttggagtctgcttttttatatttctttac---atcaagtggaactttgtcatgcagattcaa 869  Q
    ||||| |||||||  ||| ||||||||||| ||||| ||||||||| |||||||| |||||||||||   ||||||||||||| | |||||||| |||||    
34533407 atgcatagtcaggaattttgtttagcagtcggttgtttttggagtcagcttttttttatttctttacatcatcaagtggaactctctcatgcagtttcaa 34533308  T
870 tttttggatttca 882  Q
    |||||||||||||    
34533307 tttttggatttca 34533295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 716 - 766
Target Start/End: Original strand, 38634303 - 38634353
Alignment:
716 tgttcaccaatgttttgtttttcctatgcagagatcatgacgatgagaaag 766  Q
    |||||||||||||||| |||||||||||||||| | |||| ||||||||||    
38634303 tgttcaccaatgttttatttttcctatgcagaggttatgaggatgagaaag 38634353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 716 - 753
Target Start/End: Original strand, 39851268 - 39851305
Alignment:
716 tgttcaccaatgttttgtttttcctatgcagagatcat 753  Q
    |||||||||||||||| |||||||||||||||||||||    
39851268 tgttcaccaatgttttatttttcctatgcagagatcat 39851305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 734 - 767
Target Start/End: Original strand, 38637319 - 38637352
Alignment:
734 ttttcctatgcagagatcatgacgatgagaaaga 767  Q
    |||| |||||||||||||||||||||||||||||    
38637319 tttttctatgcagagatcatgacgatgagaaaga 38637352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110490 times since January 2019
Visitors: 1335