View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-21-02 (Length: 328)

Name: J5-21-02
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-21-02
J5-21-02
[»] chr4 (4 HSPs)
chr4 (163-328)||(421292-421457)
chr4 (28-85)||(421157-421214)
chr4 (28-85)||(30815613-30815670)
chr4 (1-31)||(421453-421483)
[»] chr5 (2 HSPs)
chr5 (28-85)||(10369572-10369629)
chr5 (28-85)||(38481565-38481622)
[»] chr3 (1 HSPs)
chr3 (28-85)||(41397863-41397920)
[»] chr1 (3 HSPs)
chr1 (28-85)||(17255520-17255577)
chr1 (28-85)||(46244227-46244284)
chr1 (28-85)||(45197971-45198028)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 163 - 328
Target Start/End: Original strand, 421292 - 421457
Alignment:
163 ctaattgccactcctaattttaaacttataaaaactttttgctttgaactcttaatctcacacacttattgagttttatagtggaaatgacattttaata 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
421292 ctaattgccactcctaattttaaacttataaaaactttttgctttgaactcttaatctcacacacttattgagttttatagtggaaatgacattttaata 421391  T
263 tctagtttttgggcattgaatgagggccataaactgttctaacttgttttttagtaataaaattct 328  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
421392 tctagtttttgggcattaaatgagggccataaactgttctaacttgttttttagtaataaaattct 421457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 421157 - 421214
Alignment:
28 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
421157 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 421214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 30815670 - 30815613
Alignment:
28 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30815670 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 30815613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 421453 - 421483
Alignment:
1 attcttacattgtatcagccagtgttgaatt 31  Q
    |||||||||||||||||||||||||||||||    
421453 attcttacattgtatcagccagtgttgaatt 421483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 10369572 - 10369629
Alignment:
28 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10369572 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 10369629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 38481565 - 38481622
Alignment:
28 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38481565 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 38481622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 41397920 - 41397863
Alignment:
28 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41397920 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 41397863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 17255577 - 17255520
Alignment:
28 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17255577 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 17255520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 46244227 - 46244284
Alignment:
28 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46244227 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 46244284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 45198028 - 45197971
Alignment:
28 aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt 85  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||    
45198028 aattggatggactagatccatccatattgtttaatggatcgattggatacagtccatt 45197971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 313255 times since January 2019
Visitors: 446