View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-21-06 (Length: 348)

Name: J5-21-06
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-21-06
J5-21-06
[»] chr7 (8 HSPs)
chr7 (91-348)||(3780341-3780598)
chr7 (118-348)||(3768063-3768293)
chr7 (117-336)||(3800477-3800696)
chr7 (117-336)||(3789411-3789630)
chr7 (1-94)||(3780252-3780345)
chr7 (1-94)||(3767974-3768067)
chr7 (134-213)||(3755550-3755629)
chr7 (1-94)||(3789310-3789403)


Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 91 - 348
Target Start/End: Complemental strand, 3780598 - 3780341
Alignment:
91 aattggtccattcatgtcaatcgaagacaacacaagttcattctggcaagaagacgcaacatgtttagattggctcgatcaatatccacctcaatccgtc 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3780598 aattggtccattcatgtcaatcgaagacaacacaagttcattctggcaagaagacgcaacatgtttagattggctcgatcaatatccacctcaatccgtc 3780499  T
191 gcatatgtttcctttggtagtttggccgtaatggaccaaaaccaatttaacgaactagctttaggacttgatcttcttgataaaccttttatttgggttg 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3780498 gcatatgtttcctttggtagtttggccgtaatggaccaaaaccaatttaacgaactagctttaggacttgatcttcttgataaaccttttatttgggttg 3780399  T
291 ttcgtccgagcaatgataataaggtaaactatgcataccctgatgaatttcttggaac 348  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3780398 ttcgtccgagcaatgataataaggtaaactatgcataccctgatgaatttcttggaac 3780341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 118 - 348
Target Start/End: Complemental strand, 3768293 - 3768063
Alignment:
118 caacacaagttcattctggcaagaagacgcaacatgtttagattggctcgatcaatatccacctcaatccgtcgcatatgtttcctttggtagtttggcc 217  Q
    ||||| ||||||||||||||||||||||   || |  ||||||||||| ||| |  | ||| | ||||| |||| |||||||||||| |||||||||||     
3768293 caacaaaagttcattctggcaagaagacatgacttccttagattggctagataagcaaccatcacaatcggtcgtatatgtttccttcggtagtttggca 3768194  T
218 gtaatggaccaaaaccaatttaacgaactagctttaggacttgatcttcttgataaaccttttatttgggttgttcgtccgagcaatgataataaggtaa 317  Q
    ||||||||||||||||||||||| ||||||||  ||||||||||||||||||| || |||||| |||||||||||||||| || ||||| || |||||||    
3768193 gtaatggaccaaaaccaatttaatgaactagccctaggacttgatcttcttgacaagccttttctttgggttgttcgtcctagtaatgacaacaaggtaa 3768094  T
318 actatgcataccctgatgaatttcttggaac 348  Q
    |||||||||||||||||||||| || |||||    
3768093 actatgcataccctgatgaattcctcggaac 3768063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 117 - 336
Target Start/End: Original strand, 3800477 - 3800696
Alignment:
117 acaacacaagttcattctggcaagaagacgcaacatgtttagattggctcgatcaatatccacctcaatccgtcgcatatgtttcctttggtagtttggc 216  Q
    |||||| ||||||||| |||||||||||| |||| || ||||||||| | ||| || |  |||||||||| |||  |||||||||||||||||| ||||     
3800477 acaacaaaagttcattatggcaagaagactcaacttgcttagattggttagataaacaagcacctcaatctgtcatatatgtttcctttggtagcttggt 3800576  T
217 cgtaatggaccaaaaccaatttaacgaactagctttaggacttgatcttcttgataaaccttttatttgggttgttcgtccgagcaatgataataaggta 316  Q
     ||||||||||||||||||||||| ||||||||  ||||||||||||||||||| || |||||| |||||||||||||||| || ||||| |||||||||    
3800577 agtaatggaccaaaaccaatttaatgaactagccctaggacttgatcttcttgacaagccttttctttgggttgttcgtcctagtaatgacaataaggta 3800676  T
317 aactatgcataccctgatga 336  Q
    |||||| |||||||| ||||    
3800677 aactatacataccctaatga 3800696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 117 - 336
Target Start/End: Complemental strand, 3789630 - 3789411
Alignment:
117 acaacacaagttcattctggcaagaagacgcaacatgtttagattggctcgatcaatatccacctcaatccgtcgcatatgtttcctttggtagtttggc 216  Q
    |||||| ||||||||| |||||||||||| |||| || ||||| ||| | ||| || |  |||||||||| |||  |||||||||||||||||| ||||     
3789630 acaacaaaagttcattatggcaagaagactcaacttgcttagaatggttagataaacaagcacctcaatcagtcatatatgtttcctttggtagcttggt 3789531  T
217 cgtaatggaccaaaaccaatttaacgaactagctttaggacttgatcttcttgataaaccttttatttgggttgttcgtccgagcaatgataataaggta 316  Q
     ||||||||||||||||||||||| ||||||||  ||||||||||||||||||| || |||||| |||||||||||||||| || ||||| |||||||||    
3789530 agtaatggaccaaaaccaatttaatgaactagccctaggacttgatcttcttgacaagccttttctttgggttgttcgtcctagtaatgacaataaggta 3789431  T
317 aactatgcataccctgatga 336  Q
    |||||| |||||||| ||||    
3789430 aactatacataccctaatga 3789411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 3780345 - 3780252
Alignment:
1 ggaactaaaggaaagattgttggatgggcgccgcaaaagaagatattgaaccaccctgctattgcttgtttcattagtcattgcggatggaatt 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3780345 ggaactaaaggaaagattgttggatgggcgccgcaaaagaagatattgaaccaccctgctattgcttgtttcattagtcattgcggatggaatt 3780252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 3768067 - 3767974
Alignment:
1 ggaactaaaggaaagattgttggatgggcgccgcaaaagaagatattgaaccaccctgctattgcttgtttcattagtcattgcggatggaatt 94  Q
    ||||||||||||||||| ||| | ||||  ||||| ||||||||||||||||| |||||||| |||||||||||||||||||| || |||||||    
3768067 ggaactaaaggaaagatcgttagttgggtaccgcagaagaagatattgaaccatcctgctatagcttgtttcattagtcattgtggttggaatt 3767974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 134 - 213
Target Start/End: Complemental strand, 3755629 - 3755550
Alignment:
134 tggcaagaagacgcaacatgtttagattggctcgatcaatatccacctcaatccgtcgcatatgtttcctttggtagttt 213  Q
    ||||||||||| | ||||||  |||| ||| | ||||||||||||||| |||| |||  ||||||||| |||||||||||    
3755629 tggcaagaagatgaaacatgcatagaatggttagatcaatatccacctaaatctgtcatatatgtttcatttggtagttt 3755550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 3789403 - 3789310
Alignment:
1 ggaactaaaggaaagattgttggatgggcgccgcaaaagaagatattgaaccaccctgctattgcttgtttcattagtcattgcggatggaatt 94  Q
    |||| |||||| || |||||||| ||||| || ||||  || ||||||||||| || || |||||||| ||||| ||||| || ||||||||||    
3789403 ggaagtaaaggtaaaattgttggttgggcaccacaaagtaaaatattgaaccatccagccattgcttgcttcataagtcactgtggatggaatt 3789310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106214 times since January 2019
Visitors: 1320