View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-21-08 (Length: 701)

Name: J5-21-08
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-21-08
J5-21-08
[»] chr6 (4 HSPs)
chr6 (1-463)||(8841854-8842316)
chr6 (2-340)||(25354512-25354853)
chr6 (335-463)||(25356353-25356481)
chr6 (458-579)||(8842626-8842749)
[»] chr2 (3 HSPs)
chr2 (1-322)||(15763478-15763812)
chr2 (335-463)||(15762576-15762701)
chr2 (474-579)||(15764165-15764272)
[»] chr7 (1 HSPs)
chr7 (335-421)||(39728006-39728091)


Alignment Details
Target: chr6 (Bit Score: 439; Significance: 0; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 1 - 463
Target Start/End: Complemental strand, 8842316 - 8841854
Alignment:
1 gaatatatacaatcaacaaccccggttcataagcataaactgtctattttgaaaaatgcagaagnnnnnnntatatttcaaaagcattcagcatccaata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||    
8842316 gaatatatacaatcaacaaccccggttcataagcataaactgtctattttgaaaaatgcagaagaaaaaaatatatttcaaaagcattcagcatccaata 8842217  T
101 tcaattacaattcaagccttaaatacaacatcacaatgcttataaactaatcaaaaataacaaaaattgaacacaataggcttcattcaacgaacacatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8842216 tcaattacaattcaagccttaaatacaacatcacaatgcttataaactaatcaaaaataacaaaaattgaacacaataggcttcattcaacgaacacatc 8842117  T
201 ataaggcaaaaggtcatcaatctttataactttcttcacaatgcagatccttcaagaataccaacctctccatggagaacttgtttatgaggtagtgata 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8842116 ataaggcaaaaggtcatcaatctttataactttcttcacaatgcagatccttcaagaataccaacctctccatggagaacttgtttatgaggtagtgata 8842017  T
301 tagttactttaccaaaacatccctataattaattaaacaacaaaaagtagtttttacacatcaacaaaggaataggaagaagcaaggacacaaaactaca 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8842016 tagttactttaccaaaacatccctataattaattaaacaacaaaaagtagtttttacacatcaacaaaggaataggaagaagcaaggacacaaaactaca 8841917  T
401 accacatcgagataaaatcacacacacaaatgctgaaaaatagaagaagaatangcacaattg 463  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
8841916 accacatcgagataaaatcacacacacaaatgctgaaaaatagaagaagaataagcacaattg 8841854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 2 - 340
Target Start/End: Original strand, 25354512 - 25354853
Alignment:
2 aatatatacaatcaacaaccccggttcataagcataaactgtctattttgaaaaatgcagaagnnnnnnn-tatatttcaaaagcattcagcatccaata 100  Q
    |||||||||||| | ||| ||| |||||||||||||| |||||||||||||||||||||||||        ||||||| |||||||||||||||||||||    
25354512 aatatatacaattaccaaaccctgttcataagcataagctgtctattttgaaaaatgcagaagaaaaaaaatatattttaaaagcattcagcatccaata 25354611  T
101 tcaattacaattcaagccttaaatacaacatcacaatgcttataaactaatcaaaaataaca-aaaattgaacacaataggcttcattcaacgaacacat 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
25354612 tcaattacaattcaagccttaaatacaacatcacaatgcttataaactaatccaaaataacagaaaattgaacacaataggcttcattcaacgaacacat 25354711  T
200 cataaggcaaaag-gtcatcaatctttataactttcttcacaatgcagatccttcaagaataccaacctctccatggagaacttgtttatgaggtagtga 298  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||| |||||||||||||||||||  ||||||| |||||| ||||||||||||||||    
25354712 cataaggcaaaaatgtcatcaatctttataactttcttcacaatgcaaatccttcaagaataccaactactccatgaagaactcgtttatgaggtagtga 25354811  T
299 tatagttactttaccaaaacatccctataattaattaaacaa 340  Q
    |||||||||||||||||||||||||||||| |||||||||||    
25354812 tatagttactttaccaaaacatccctataaataattaaacaa 25354853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 335 - 463
Target Start/End: Original strand, 25356353 - 25356481
Alignment:
335 aaacaacaaaaagtagtttttacacatcaacaaaggaataggaagaagcaaggacacaaaactacaaccacatcgagataaaatcacacacacaaatgct 434  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||||    
25356353 aaacaacaaaaagtagtttttacacatcaacaaaggaattggaagaatcaatgacacaaaactacaaccacatcgagataaaatcacacgcacaaatgct 25356452  T
435 gaaaaatagaagaagaatangcacaattg 463  Q
    ||||||||||||||||||| |||||||||    
25356453 gaaaaatagaagaagaataagcacaattg 25356481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 458 - 579
Target Start/End: Complemental strand, 8842749 - 8842626
Alignment:
458 caattgcaataaattataactagtcgccgacccgtgcgatagcacgggttaatgatgagattca-ttncaagcaacatatggac-ttggtttaaataaaa 555  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||| |||||||||||    
8842749 caattgcaataaattataactagtcgccgacccgtgcgatagcacgggttaatgatgagattcatttacaagcaacatatggactttgttttaaataaaa 8842650  T
556 aatattcaataaaaacaacatgaa 579  Q
    ||||||||||||||||||||||||    
8842649 aatattcaataaaaacaacatgaa 8842626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 15763812 - 15763478
Alignment:
1 gaatatatacaatcaacaaccccggttcataagcataaactgtctattttgaaaaatgcagaagnnnnnnntatatttcaaaagcattcagcatccaata 100  Q
    ||||||||||||||| |||||||| ||||||| ||||| |||| ||||||||||||||||||||       |||||||||||||||||||||||||||||    
15763812 gaatatatacaatcagcaaccccgattcataaacataagctgtttattttgaaaaatgcagaagaaaaaaatatatttcaaaagcattcagcatccaata 15763713  T
101 tcaattacaattcaagccttaaatacaacatcacaatgcttataaactaatcaaaaataaca-aaaattgaacacaataggcttcattcaacgaacacat 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||    
15763712 tcaattacaattcaagccttaaatacaacatcacaatgcttataaactaatcaaaaataacagaaaactgaacacaataggcttcattcaacgaacatat 15763613  T
200 cata------------aggcaaaaggtcatcaatctttataactttcttcacaatgcagatccttcaagaataccaacctctccatggagaacttgttta 287  Q
    ||||            ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
15763612 cataaggcaaaaggttaggcaaaaggttatcaatctttataactttcttcacaatgcagatccttcaagaataccaacctctccatggagaactcgttta 15763513  T
288 tgaggtagtgatatagttactttaccaaaacatcc 322  Q
    |||||||||||||||||||||||||||||||||||    
15763512 tgaggtagtgatatagttactttaccaaaacatcc 15763478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 335 - 463
Target Start/End: Complemental strand, 15762701 - 15762576
Alignment:
335 aaacaacaaaaagtagtttttacacatcaacaaaggaataggaagaagcaaggacacaaaactacaaccacatcgagataaaatcacacacacaaatgct 434  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |   |    
15762701 aaacaacaaaaagtagtttttacacatcaacaaaggattaggaagaagcaatgacacaaaactacaaccacatcgagataaaatcacacgcacaca---t 15762605  T
435 gaaaaatagaagaagaatangcacaattg 463  Q
    |||||||| |||||||||| |||||||||    
15762604 gaaaaatataagaagaataagcacaattg 15762576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 474 - 579
Target Start/End: Complemental strand, 15764272 - 15764165
Alignment:
474 taactagtcgccgacccgtgcgatagcacgggttaatgatgagattca-ttncaagcaacatatggac-ttggtttaaataaaaaatattcaataaaaac 571  Q
    ||||||||||||||||| ||| || ||||||||||||||||||||||| || |||||||||||||||| ||| ||||||||||| |||||||||||||||    
15764272 taactagtcgccgacccatgctatcgcacgggttaatgatgagattcatttacaagcaacatatggactttgttttaaataaaagatattcaataaaaac 15764173  T
572 aacatgaa 579  Q
    ||||||||    
15764172 aacatgaa 15764165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 335 - 421
Target Start/End: Complemental strand, 39728091 - 39728006
Alignment:
335 aaacaacaaaaagtagtttttacacatcaacaaaggaataggaagaagcaaggacacaaaactacaaccacatcgagataaaatcac 421  Q
    |||||||||||| ||||||||||   |||||||| ||| ||| |||||||| ||||| ||| || ||||||| |||||| |||||||    
39728091 aaacaacaaaaattagtttttacggttcaacaaatgaacaggcagaagcaatgacacgaaa-tataaccacaacgagatcaaatcac 39728006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360882 times since January 2019
Visitors: 487