View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-21-36 (Length: 654)

Name: J5-21-36
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-21-36
J5-21-36
[»] chr7 (2 HSPs)
chr7 (89-567)||(38042775-38043254)
chr7 (1-94)||(38042363-38042456)
[»] chr1 (1 HSPs)
chr1 (15-74)||(31980804-31980863)


Alignment Details
Target: chr7 (Bit Score: 394; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 89 - 567
Target Start/End: Complemental strand, 38043254 - 38042775
Alignment:
89 caattgtttggatgtacaccacactattgagcatcatctccgctactacattataagtcctcacatttacacgtcaccttaaacactagtaaccaaacaa 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38043254 caattgtttggatgtacaccacactattgagcatcatctccgctactacattataagtcctcacatttacacgtcaccttaaacactagtaaccaaacaa 38043155  T
189 catggatccttcgtactaacccaaaagtcaccgaatcatttatttttctcttatttccaatttattagtattcattcatttatcaattnnnnnnngtcct 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||    
38043154 catggatccttcgtactaacccaaaagtcaccgaatcatttatttttctcttatttccaatttattagtattcattcatttatcaattaaaaaaagtcct 38043055  T
289 tatccgtgctacaacnnnnnnnnnnnnnnnnnnngataacatactaatccacgttcccacttaggcattggcaaatcacaattaacagcaactaactact 388  Q
    |||||||||||||||                   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38043054 tatccgtgctacaacttttttttgttttgtttttgataacatactaatccacgttcccacttaggcattggcaaatcacaattaacagcaactaactact 38042955  T
389 atatataaccatcaaccaaacaccttccttcccttcttttcaatccatcaccctcttattacactttcacaccttctaaactttctataaccatgccaac 488  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38042954 atatataaccatcaaccaaacaccttccttcccttcttttcaatccatcaccctcttattacactttcacaccttctaaactttctataaccatgccaac 38042855  T
489 tacacttagaacaagaagaagaaacaacctcaaacgcctcaattacctatgtttctcaactttcatac-acctcaatctc 567  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
38042854 tacacttagaacaagaagaagaaacaacctcaaacgcctcaattacctatgtttctcaactttcatacaacctcaatctc 38042775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 38042456 - 38042363
Alignment:
1 catattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatgaaggacgtgaagtccaattg 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38042456 catattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatgaaggacgtgaagtccaattg 38042363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 74
Target Start/End: Original strand, 31980804 - 31980863
Alignment:
15 ccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatg 74  Q
    ||||| ||||||||| |||| || ||||||||||||||||| |||| ||| |||||||||    
31980804 ccttatatggattttagaagatcgatgcaagagatggtggaggcgcgaccggagttgatg 31980863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105998 times since January 2019
Visitors: 1319