View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-21-50 (Length: 102)

Name: J5-21-50
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-21-50
J5-21-50
[»] chr6 (2 HSPs)
chr6 (1-102)||(8842312-8842412)
chr6 (28-77)||(25354397-25354446)
[»] chr2 (2 HSPs)
chr2 (28-102)||(15763877-15763950)
chr2 (1-32)||(15763808-15763839)
[»] chr3 (1 HSPs)
chr3 (39-102)||(42235561-42235622)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 2e-46; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 8842312 - 8842412
Alignment:
1 tattcaacaataatgtttataggattcagtatttctatttttcgttatctgttttcgtttgtcatgaccattaacaagagccagggnacaatcccttaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
8842312 tattcaacaataatgtttataggattcagtatttctatttttcgttatctgttttcgtttgtcatgaccattaacaagagccaggg-acaatcccttaat 8842410  T
101 ca 102  Q
    ||    
8842411 ca 8842412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 25354446 - 25354397
Alignment:
28 agtatttctatttttcgttatctgttttcgtttgtcatgaccattaacaa 77  Q
    ||||| |||||||||||||||||||||||||||| ||||| |||||||||    
25354446 agtatctctatttttcgttatctgttttcgtttgccatgatcattaacaa 25354397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 55; Significance: 4e-23; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 28 - 102
Target Start/End: Original strand, 15763877 - 15763950
Alignment:
28 agtatttctatttttcgttatctgttttcgtttgtcatgaccattaacaagagccagggnacaatcccttaatca 102  Q
    ||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||    
15763877 agtatctctatttttcgttatctgttttcgtttgccatgaccattaacaagagtcaggg-acaatcccttaatca 15763950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 15763808 - 15763839
Alignment:
1 tattcaacaataatgtttataggattcagtat 32  Q
    ||||||||||||||||||||||||||||||||    
15763808 tattcaacaataatgtttataggattcagtat 15763839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 39 - 102
Target Start/End: Original strand, 42235561 - 42235622
Alignment:
39 ttttcgttatctgttttcgtttgtcatgaccattaacaagagccagggnacaatcccttaatca 102  Q
    |||||||||||||||| |||||| ||||||||||||||||||||| || |||||||||||||||    
42235561 ttttcgttatctgttt-cgtttgccatgaccattaacaagagccaagg-acaatcccttaatca 42235622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 308511 times since January 2019
Visitors: 441