View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-21-77 (Length: 140)

Name: J5-21-77
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-21-77
J5-21-77
[»] chr1 (1 HSPs)
chr1 (1-140)||(49952939-49953078)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 2e-71; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 2e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 49952939 - 49953078
Alignment:
1 gttagcaccgccgcgacatgagtgcaagtgtctgggttcgaacccacaacatcttattctattccaatttatttgtatgataaaggagctatatgtaata 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49952939 gttagcaccgctgcgacatgagtgcaagtgtctgggttcgaacccacaacatcttattctattccaatttatttgtatgataaaggagctatatgtaata 49953038  T
101 tgtagatgaaattaaaggagggagcaaagcaaagtattaa 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
49953039 tgtagatgaaattaaaggagggagcaaagcaaagtattaa 49953078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110496 times since January 2019
Visitors: 1335