View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-21-80 (Length: 122)

Name: J5-21-80
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] J5-21-80
[»] chr1 (1 HSPs)
chr1 (26-122)||(34668245-34668341)

Alignment Details
Target: chr1 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 26 - 122
Target Start/End: Complemental strand, 34668341 - 34668245
26 tacaattgtctacaaatcagaattgtacatcaatataaactgctaaaagttatgaacaagaaagataatcaaataatcatacttaatgtggtatcag 122  Q
    ||||||||||||||||||| |||||||||||||||| || |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||    
34668341 tacaattgtctacaaatcaaaattgtacatcaatattaattgctaacagttttgaacaagaaagataatcaaataatcatacttaatgtggtatcag 34668245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 362122 times since January 2019
Visitors: 488