View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-45 (Length: 711)

Name: J5-45
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-45
J5-45
[»] chr8 (2 HSPs)
chr8 (255-596)||(43308700-43309043)
chr8 (1-260)||(43309249-43309508)


Alignment Details
Target: chr8 (Bit Score: 309; Significance: 1e-174; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 255 - 596
Target Start/End: Original strand, 43308700 - 43309043
Alignment:
255 attaatttttgcaactgtgtcacacaattactgaacgaagtctcatttccactatgtggaggtaagttctaaggcaggttttagcatttgaaaattgttt 354  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43308700 attaatttttgcaactgtgtcacacaattactgaacgaagtctcatttccactatgtggaggtaagttctaaggcaggttttagcatttgaaaattgttt 43308799  T
355 caaactttaaatagaagaattgacaatcatccttgttatagcgtgcggtgtggtgtgacacaatgtttagattagtgtcggtgtgtcaatctagcaaaaa 454  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
43308800 caaactttaaatagaagaattgacaatcatccttgttatagcgtgcggtgtggtgtgacacaatgttt-gattagtgtcggtgtgtcaatctagcaaaaa 43308898  T
455 caagtgatttagatggagcactttttattttcttaaaattaaagagggatccaaatcactttttatttactcaccgatggctctgaagctcgctaccact 554  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
43308899 caagtgatttagatggagcactttttattttcttaaaattaaagagggattcaaatcactttttatttactcaccgatggctctgaagctcgctaccact 43308998  T
555 tt-cccatctctgcct-caatgccgacc-atcatcccggaggccc 596  Q
    || ||||||||||||| ||||||||||| ||||||||||||||||    
43308999 ttccccatctctgcctccaatgccgaccaatcatcccggaggccc 43309043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 43309249 - 43309508
Alignment:
1 ccaaacccgttcaaatgcgtgaacctccttttgttccctttggaccggttactatgcccagaccttggaccggtcggcctccacttccgccgagtaagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43309249 ccaaacccgttcaaatgcgtgaacctccttttgttccctttggaccggttactatgcccagaccttggaccggtcggcctccacttccgccgagtaagaa 43309348  T
101 gaagctcaaggagtttgattcttttgttcttcccccgccacataagaagggcgttaaaccggttcagtctcccggtccgtttttgcccgggactagcccg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
43309349 gaagctcaaggagtttgattcttttgttcttcccccgccacataagaagggtgttaaaccggttcagtctcccggtccgtttttgcccgggactagcccg 43309448  T
201 aggtatgtgatgtctagagaagaagtgttgggtgaaccgttgacgaaggaggagattaat 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43309449 aggtatgtgatgtctagagaagaagtgttgggtgaaccgttgacgaaggaggagattaat 43309508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 315100 times since January 2019
Visitors: 446