View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-1 (Length: 631)

Name: J5-5-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-1
J5-5-1
[»] chr2 (11 HSPs)
chr2 (109-571)||(8504373-8504836)
chr2 (1-115)||(8504926-8505040)
chr2 (109-166)||(7069197-7069254)
chr2 (109-166)||(33429136-33429193)
chr2 (109-166)||(4108310-4108367)
chr2 (109-166)||(16718639-16718696)
chr2 (109-166)||(36428853-36428910)
chr2 (109-166)||(41184490-41184547)
chr2 (120-166)||(40288061-40288107)
chr2 (120-166)||(42046078-42046124)
chr2 (109-166)||(43359107-43359164)
[»] chr7 (15 HSPs)
chr7 (109-166)||(41311057-41311114)
chr7 (109-166)||(8648383-8648440)
chr7 (109-166)||(40331404-40331461)
chr7 (109-166)||(11640298-11640355)
chr7 (109-166)||(12395197-12395254)
chr7 (109-166)||(22904838-22904895)
chr7 (109-165)||(49079257-49079313)
chr7 (109-160)||(2932926-2932977)
chr7 (109-166)||(25411972-25412029)
chr7 (109-166)||(27897567-27897624)
chr7 (109-172)||(19345609-19345672)
chr7 (120-166)||(29689282-29689328)
chr7 (120-166)||(31759996-31760042)
chr7 (109-166)||(26004166-26004223)
chr7 (126-166)||(40941878-40941918)
[»] chr8 (17 HSPs)
chr8 (109-171)||(41674482-41674544)
chr8 (109-166)||(2880275-2880332)
chr8 (120-166)||(43485398-43485444)
chr8 (109-166)||(29604360-29604417)
chr8 (109-166)||(40154492-40154549)
chr8 (109-166)||(417682-417739)
chr8 (109-166)||(17096627-17096684)
chr8 (109-173)||(34047762-34047827)
chr8 (109-166)||(43331747-43331804)
chr8 (109-166)||(44309569-44309626)
chr8 (109-169)||(5982533-5982593)
chr8 (109-165)||(40972411-40972467)
chr8 (109-166)||(30777619-30777677)
chr8 (109-171)||(34058176-34058238)
chr8 (134-171)||(5215692-5215729)
chr8 (109-166)||(40824467-40824524)
chr8 (127-171)||(1426325-1426369)
[»] scaffold0325 (1 HSPs)
scaffold0325 (109-166)||(1559-1616)
[»] scaffold0067 (1 HSPs)
scaffold0067 (109-166)||(41391-41448)
[»] chr6 (9 HSPs)
chr6 (109-166)||(926543-926600)
chr6 (109-171)||(21998613-21998674)
chr6 (109-166)||(10888155-10888213)
chr6 (109-166)||(22084826-22084883)
chr6 (120-174)||(24248799-24248853)
chr6 (109-166)||(26315450-26315508)
chr6 (109-166)||(2138353-2138410)
chr6 (109-166)||(6295382-6295438)
chr6 (109-166)||(14501029-14501086)
[»] chr5 (13 HSPs)
chr5 (109-166)||(2011404-2011461)
chr5 (109-172)||(36409903-36409966)
chr5 (109-171)||(6335388-6335450)
chr5 (109-166)||(9499231-9499288)
chr5 (109-166)||(16602709-16602766)
chr5 (109-166)||(34064961-34065018)
chr5 (109-171)||(9499386-9499448)
chr5 (112-166)||(19238797-19238851)
chr5 (109-166)||(12336217-12336274)
chr5 (109-166)||(29666164-29666221)
chr5 (109-173)||(18480064-18480128)
chr5 (109-167)||(23408254-23408313)
chr5 (126-175)||(27116456-27116505)
[»] chr1 (19 HSPs)
chr1 (109-166)||(33081991-33082048)
chr1 (109-166)||(5360548-5360605)
chr1 (109-166)||(35912978-35913035)
chr1 (109-166)||(39085060-39085117)
chr1 (109-166)||(40868482-40868539)
chr1 (109-177)||(43536869-43536937)
chr1 (109-166)||(33985914-33985972)
chr1 (120-166)||(42317182-42317228)
chr1 (109-166)||(50534230-50534287)
chr1 (109-166)||(51873620-51873677)
chr1 (109-165)||(24677898-24677954)
chr1 (109-172)||(13216442-13216505)
chr1 (109-166)||(44978872-44978930)
chr1 (109-171)||(46281940-46282002)
chr1 (120-166)||(51984937-51984983)
chr1 (109-173)||(12227117-12227182)
chr1 (109-166)||(41568448-41568505)
chr1 (110-169)||(17644897-17644957)
chr1 (120-172)||(51369326-51369378)
[»] chr4 (14 HSPs)
chr4 (109-173)||(17370622-17370686)
chr4 (109-166)||(37992027-37992085)
chr4 (109-166)||(1792173-1792230)
chr4 (109-166)||(5474356-5474413)
chr4 (109-166)||(48207081-48207138)
chr4 (109-166)||(52324312-52324370)
chr4 (126-169)||(47302396-47302439)
chr4 (121-166)||(3690513-3690558)
chr4 (109-166)||(6882879-6882936)
chr4 (109-166)||(25684440-25684497)
chr4 (109-166)||(48262565-48262622)
chr4 (134-166)||(30168471-30168503)
chr4 (112-171)||(40438983-40439043)
chr4 (126-166)||(49286972-49287012)
[»] chr3 (13 HSPs)
chr3 (109-176)||(47175460-47175527)
chr3 (109-171)||(20199345-20199407)
chr3 (109-166)||(4521615-4521672)
chr3 (109-166)||(26001198-26001255)
chr3 (109-166)||(36790233-36790290)
chr3 (109-166)||(39540674-39540731)
chr3 (109-172)||(24397371-24397434)
chr3 (120-160)||(4663495-4663535)
chr3 (112-166)||(28146664-28146718)
chr3 (109-166)||(51996763-51996821)
chr3 (109-166)||(44568586-44568643)
chr3 (120-160)||(27079736-27079776)
chr3 (120-160)||(27082703-27082743)
[»] scaffold0009 (1 HSPs)
scaffold0009 (126-166)||(214143-214183)


Alignment Details
Target: chr2 (Bit Score: 393; Significance: 0; HSPs: 11)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 109 - 571
Target Start/End: Original strand, 8504373 - 8504836
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatttgaattacaatctaaaattatattacctccaaaaat 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8504373 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatttgaattacaatctaaaattatattacctccaaaaat 8504472  T
209 tctttcatccaaacaaacaaaacagaataattctagacctgttatnnnnnnnnttgagaccaaaattcatagttattttgaatatgagacaaaaaataac 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||    
8504473 tctttcatccaaacaaacaaaacagaataattctagacctgttataaaaaaaattgagaccaaaattcatagttattttgaatatgagacaaaaaataac 8504572  T
309 ccgtgcaaatgacttcctatattggagatatttaattagattggacaagaagtcgctagctagctgtctttctatggatctaatgagaaaaattagtggg 408  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8504573 tcgtgcaaatgacttcctatattggagatatttaattagattggacaagaagtcgctagctagctgtctttctatggatctaatgagaaaaattagtggg 8504672  T
409 attcatatccgtcaactactcacatgaataatcattgacattttgtgtatgtatgc-ttgacgactgaataataagaggggaaaagtnccttggcaaaat 507  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||    
8504673 attcatatccgtcaactactcacatgaataatcattgacattttgtgtatgtatgctttgacgactgaataataagaggggaaaagttccttgtcaaaat 8504772  T
508 tcnagaaaaaacaaacccatatt-aatcccanggaatatcataatttggnatttttattatggcc 571  Q
    || |||||||||||| ||||||| ||||| | ||||||||||||||||| |||||||||||||||    
8504773 tcaagaaaaaacaaa-ccatattaaatccaatggaatatcataatttggtatttttattatggcc 8504836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 8504926 - 8505040
Alignment:
1 gaattctcctctatgattcggtgcaagtcataacatttatttgtaagcatagcttcttaaaatttctttcttatgccattacaagaaattgacaaattca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8504926 gaattctcctctatgattcggtgcaagtcataacatttatttgtaagcatagcttcttaaaatttctttcttatgccattacaagaaattgacaaattca 8505025  T
101 gaatttgaattaatt 115  Q
    |||||||||||||||    
8505026 gaatttgaattaatt 8505040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 7069254 - 7069197
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||||||| ||||||||||||||||    
7069254 attaatttaatgtttggtgtacccgtacactcaaaatgttgggtgtaccataaaattt 7069197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 33429193 - 33429136
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||||||||||||| |||||    
33429193 attaatttaatgtttggtgtaccggtacactcaaaatgttgagtgtaccatagaattt 33429136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 4108367 - 4108310
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||  ||||||||| |||||    
4108367 attaatttaatgtttggtgtaccggtacactcaaaatgttggatgtaccatagaattt 4108310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 16718696 - 16718639
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||| |||| ||||||||| |||||    
16718696 attaatttaatgtttggtgtaccggtacactcaaaatattgaatgtaccatagaattt 16718639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 36428853 - 36428910
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||  ||||||||| |||||    
36428853 attaatttaatgtttggtgtaccggtacactcaaaatgttggatgtaccatagaattt 36428910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 41184547 - 41184490
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||  ||||||||| |||||    
41184547 attaatttaatgtttggtgtaccggtacactcaaaatgttggatgtaccatagaattt 41184490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 120 - 166
Target Start/End: Original strand, 40288061 - 40288107
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||| |||||| ||||||||||||| |||| |||||||||||||||    
40288061 atttggtgtaccggtacactcaaaattttgaatgtaccataaaattt 40288107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 120 - 166
Target Start/End: Complemental strand, 42046124 - 42046078
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||| ||||||| |||||||||| |||||||||||||||| |||||    
42046124 atttggtgtaccaatacactcaaattgttgagtgtaccatagaattt 42046078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 43359164 - 43359107
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||| |||||| ||||||||||| ||||||||||||| |||  ||||||||| |||||    
43359164 attattttaatgtttgatgtaccggtacactcaaaatattggatgtaccatagaattt 43359107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 6e-17; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 41311114 - 41311057
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||    
41311114 attaatttaatatttggtgtaccggtacactcaaaatgttgagtgtaccatagaattt 41311057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 8648383 - 8648440
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||| ||||||||||| |||||| |||||||||||||||||||||||||||| |||||    
8648383 attattttaatatttggtgtaccggtacactcaaaatgttgagtgtaccatataattt 8648440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 40331404 - 40331461
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||||||||||||| |||||    
40331404 attaatttaatgtttggtgtaccggtacactcaaaatgttgagtgtaccatataattt 40331461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 11640355 - 11640298
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| |||||    
11640355 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 11640298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 12395254 - 12395197
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||  |||| |||||| ||||||||||||||||| ||||||||||||||||    
12395254 attaatttaacgtttggtgtaccggtacactcaaaatgttgggtgtaccataaaattt 12395197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 22904838 - 22904895
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||| |||||| || |||||||| ||||||||||||||||| ||||||||||||||||    
22904838 attattttaatgttggatgtaccggtacactcaaaatgttgggtgtaccataaaattt 22904895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 109 - 165
Target Start/End: Complemental strand, 49079313 - 49079257
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaatt 165  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| ||||    
49079313 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaatt 49079257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 109 - 160
Target Start/End: Original strand, 2932926 - 2932977
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccata 160  Q
    ||||||||||| |||| |||||| ||||||||||||||||| ||||||||||    
2932926 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccata 2932977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 25411972 - 25412029
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||  ||||||||| |||||    
25411972 attaatttaatgtttggtgtaccggtacactcaaaatgttggatgtaccatacaattt 25412029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 27897567 - 27897624
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||||||  |||||||||| |||||    
27897567 attaatttaatgtttggtgtaccggtacactcaaaatgttaggtgtaccatagaattt 27897624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 109 - 172
Target Start/End: Complemental strand, 19345672 - 19345609
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatt 172  Q
    ||||||||||| |||| |||| | ||||| ||||||| |||||||||||||| ||||| |||||    
19345672 attaatttaatgtttggtgtatcggtacaatcaaaatattgagtgtaccatagaatttgccatt 19345609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 120 - 166
Target Start/End: Original strand, 29689282 - 29689328
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||| |||||||||||||||||| | |||||||||||||| |||||    
29689282 atttggtgtaccagtacactcaaatttttgagtgtaccatagaattt 29689328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 120 - 166
Target Start/End: Complemental strand, 31760042 - 31759996
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||| |||||| ||||||||||| | ||||||||||||||||||||    
31760042 atttggtgtaccggtacactcaaatttttgagtgtaccataaaattt 31759996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 26004223 - 26004166
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||| |||||||||  ||||||||| |||||    
26004223 attaatttaatgtttggtgtaccggtacacttaaaatgttggatgtaccatagaattt 26004166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 126 - 166
Target Start/End: Complemental strand, 40941918 - 40941878
Alignment:
126 tgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||| |||||||||| |||||||||||||||| |||||    
40941918 tgtaccaatacactcaaattgttgagtgtaccatagaattt 40941878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 17)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 41674544 - 41674482
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    ||||||||||| |||| |||||| |||||||||||||||||||||||||||| ||||| ||||    
41674544 attaatttaatgtttggtgtaccggtacactcaaaatgttgagtgtaccatagaatttgccat 41674482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 2880275 - 2880332
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||||||||||||| |||||    
2880275 attaatttaatgtttggtgtaccggtacactcaaaatgttgagtgtaccatagaattt 2880332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 166
Target Start/End: Original strand, 43485398 - 43485444
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||||| |||||||||||| ||||||||||||||||||||    
43485398 atttgatgtaccaatacactcaaaattttgagtgtaccataaaattt 43485444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 29604360 - 29604417
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||||||||||| |||| ||||||| |||||||||||||| |||||    
29604360 attaatttaatgtttgatgtaccaatacattcaaaatattgagtgtaccatagaattt 29604417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 40154549 - 40154492
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| ||||||  |||||||||||||||| ||||||||||||||||    
40154549 attaatttaatgtttggtgtaccgatacactcaaaatgttgggtgtaccataaaattt 40154492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 417739 - 417682
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||| ||||||||| |||||  ||||||||||||| |||||||||||||| |||||    
417739 attaatataatatttggtgtactggtacactcaaaatattgagtgtaccatagaattt 417682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 17096627 - 17096684
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| ||||||  |||||||||||||||| |||||||||| |||||    
17096627 attaatttaatgtttggtgtaccgatacactcaaaatgttgggtgtaccatagaattt 17096684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 173
Target Start/End: Original strand, 34047762 - 34047827
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccattt 173  Q
    |||||||||||| |||| |||||| ||||||||||| ||||| |||||||||| ||||| ||||||    
34047762 attaatttaataatttggtgtaccggtacactcaaattgttgggtgtaccatagaatttgccattt 34047827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 43331804 - 43331747
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||  |||| |||||| ||||||||||||||||| |||||||||| |||||    
43331804 attaatttaaagtttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 43331747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 44309626 - 44309569
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||  |||| |||||| ||||||||||||||||| |||||||||| |||||    
44309626 attaatttaaagtttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 44309569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 5982533 - 5982593
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttcc 169  Q
    ||||||||||| |||  |||||| ||||||||||||||||| |||||||||  ||||||||    
5982533 attaatttaatgtttagtgtacccgtacactcaaaatgttgggtgtaccattgaattttcc 5982593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 109 - 165
Target Start/End: Original strand, 40972411 - 40972467
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaatt 165  Q
    ||||||||||| |||| |||||| ||||||||||||| |||| ||||||||| ||||    
40972411 attaatttaatgtttggtgtaccggtacactcaaaatattgaatgtaccatagaatt 40972467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 30777619 - 30777677
Alignment:
109 attaatttaatattt-gatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||| |||| | |||||| |||||||||||||||||| ||||||||| |||||    
30777619 attaatttaaaattttggtgtaccggtacactcaaaatgttgaatgtaccatagaattt 30777677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 109 - 171
Target Start/End: Original strand, 34058176 - 34058238
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    ||||||||||| |||| ||||| |||||||||| |||||||  ||||||||| ||||| ||||    
34058176 attaatttaatgtttggtgtacaagtacactcagaatgttggatgtaccatagaatttgccat 34058238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 171
Target Start/End: Original strand, 5215692 - 5215729
Alignment:
134 tacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    |||||||||||| |||||||||||||||||||| ||||    
5215692 tacactcaaaatattgagtgtaccataaaatttgccat 5215729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 40824524 - 40824467
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||||||| |||||| ||||||||||||| |||  | ||||||| |||||    
40824524 attaatttaatatttggtgtaccggtacactcaaaatattggatttaccatagaattt 40824467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 127 - 171
Target Start/End: Complemental strand, 1426369 - 1426325
Alignment:
127 gtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    |||||||||||||||||||  ||||||||||||| ||||| ||||    
1426369 gtaccagtacactcaaaattgtgagtgtaccatagaatttcccat 1426325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0325 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0325
Description:

Target: scaffold0325; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 1559 - 1616
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||||||||||||||| |||||||||||||||||  ||||||||| |||||    
1559 attaatttaatatttgatgtaccggtacactcaaaatgttggatgtaccatagaattt 1616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0067
Description:

Target: scaffold0067; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 41448 - 41391
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||||||||||||| |||||    
41448 attaatttaatgtttggtgtaccggtacactcaaaatgttgagtgtaccatagaattt 41391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 9)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 926600 - 926543
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| ||| |||||||||||||||||||||||||  |||||||||||||||    
926600 attaatttaatgtttaatgtaccagtacactcaaaatgttggatgtaccataaaattt 926543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 21998674 - 21998613
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    |||||||||||||||| |||||| |||||| ||||||||||| ||||||||| ||||||||||    
21998674 attaatttaatatttggtgtaccggtacacacaaaatgttga-tgtaccatagaattttccat 21998613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 10888155 - 10888213
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||| ||||||||||||||||||||||| |||||  ||||||||| |||||    
10888155 attaatttaataatttgatgtaccagtacactcaaattgttggatgtaccatataattt 10888213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 22084883 - 22084826
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||||||  |||||| |||||||||||||||||  ||||||||| |||||    
22084883 attaatttaatattttgtgtaccggtacactcaaaatgttggatgtaccatagaattt 22084826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 24248853 - 24248799
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatttg 174  Q
    ||||| |||||| ||||||||||| | |||||||||||||| ||||| |||||||    
24248853 atttggtgtaccggtacactcaaatttttgagtgtaccatagaatttgccatttg 24248799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 26315508 - 26315450
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||| |||| |||||| ||||||||||| |||||  |||||||||||||||    
26315508 attaatttaataatttggtgtaccggtacactcaaattgttggatgtaccataaaattt 26315450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 2138410 - 2138353
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||| | ||||||||||| ||||||||| ||||||    
2138410 attaatttaatgtttggtgtacctgtaaattcaaaatgttgggtgtaccatgaaattt 2138353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 6295438 - 6295382
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||||||||  |||||||||||||||||| ||||| |||| |||||    
6295438 attaatttaatgtttgatgtat-agtacactcaaaatgttgggtgtatcatagaattt 6295382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 14501086 - 14501029
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||  |||| |||||| |||||||||||||||||  ||||||||| |||||    
14501086 attaatttaacgtttggtgtaccggtacactcaaaatgttggatgtaccatataattt 14501029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 13)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 2011404 - 2011461
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||||||||||||| |||||    
2011404 attaatttaatgtttggtgtaccggtacactcaaaatgttgagtgtaccatagaattt 2011461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 109 - 172
Target Start/End: Complemental strand, 36409966 - 36409903
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatt 172  Q
    ||||||||||| |||| ||||||  |||||||||||||||| |||||||||||||||| |||||    
36409966 attaatttaatgtttggtgtaccgatacactcaaaatgttgggtgtaccataaaatttgccatt 36409903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 6335450 - 6335388
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| ||||| ||||    
6335450 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaatttgccat 6335388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 9499288 - 9499231
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| | |||| |||||||||||||||||||||||||||| |||||    
9499288 attaatttaatgtttggtataccggtacactcaaaatgttgagtgtaccatagaattt 9499231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 16602709 - 16602766
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| |||||    
16602709 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 16602766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 34065018 - 34064961
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||  |||||||||||||||    
34065018 attaatttaatgtttggtgtaccggtacactcaaaatgttggatgtaccataaaattt 34064961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 9499448 - 9499386
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    ||||||||||| |||| | |||| ||||||||||||||| |||||||||||| ||||| ||||    
9499448 attaatttaatgtttggtataccggtacactcaaaatgtcgagtgtaccatagaatttgccat 9499386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 112 - 166
Target Start/End: Complemental strand, 19238851 - 19238797
Alignment:
112 aatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||| |||| |||||| ||||||||||||||||| |||||||||| |||||    
19238851 aatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 19238797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 12336274 - 12336217
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||||||| || ||||||| |||||    
12336274 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtataccatagaattt 12336217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 29666164 - 29666221
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||| | |||||||||||| |||||    
29666164 attaatttaatgtttggtgtaccggtacactcaaaatatcgagtgtaccatagaattt 29666221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 109 - 173
Target Start/End: Complemental strand, 18480128 - 18480064
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccattt 173  Q
    ||||||||||| |||| |||||| ||||||||||||| ||| || ||||||| ||||| ||||||    
18480128 attaatttaatgtttggtgtaccggtacactcaaaatattgggtataccatagaatttgccattt 18480064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 109 - 167
Target Start/End: Complemental strand, 23408313 - 23408254
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaatttt 167  Q
    |||||||||||| |||| |||||| ||||||||||| ||||| |||||||||| ||||||    
23408313 attaatttaataatttggtgtaccggtacactcaaattgttgggtgtaccatataatttt 23408254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 175
Target Start/End: Complemental strand, 27116505 - 27116456
Alignment:
126 tgtaccagtacactcaaaatgttgagtgtaccataaaattttccatttga 175  Q
    ||||||| |||||||||| | ||| ||||||||||||||||||| |||||    
27116505 tgtaccaatacactcaaatttttgggtgtaccataaaattttccttttga 27116456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 19)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 33082048 - 33081991
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||||||| |||||| ||||||||||||||||| |||||||||| |||||    
33082048 attaatttaatatttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 33081991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 5360548 - 5360605
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| |||||    
5360548 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 5360605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 35912978 - 35913035
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| || |||||||| ||||||||||||||||| |||||||||| |||||    
35912978 attaatttaatgttcgatgtaccggtacactcaaaatgttgggtgtaccatagaattt 35913035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 39085060 - 39085117
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||| ||||||||| |||||    
39085060 attaatttaatgtttggtgtaccggtacactcaaaatgttgaatgtaccatagaattt 39085117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 40868482 - 40868539
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||| ||||||||| |||||    
40868482 attaatttaatttttggtgtaccggtacactcaaaatgttgaatgtaccatagaattt 40868539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 109 - 177
Target Start/End: Complemental strand, 43536937 - 43536869
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatttgaat 177  Q
    |||| |||||| |||| |||||| ||||||||||||||||| |||||||||| ||||| ||| ||||||    
43536937 attattttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatataatttgccaattgaat 43536869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 33985972 - 33985914
Alignment:
109 attaatttaa-tatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||| |||||| || ||||||||||||||||| |||| |||||||||||||||    
33985972 attaatttaaatatttggtgcaccagtacactcaaaattttgaatgtaccataaaattt 33985914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 120 - 166
Target Start/End: Original strand, 42317182 - 42317228
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||||| |||||||||||| |||||||||||||| |||||    
42317182 atttgatgtaccaatacactcaaaattttgagtgtaccatataattt 42317228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 50534230 - 50534287
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||  ||||||||| |||||    
50534230 attaatttaatgtttggtgtaccggtacactcaaaatgttggatgtaccatagaattt 50534287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 51873620 - 51873677
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| ||| ||||||| |||||||||||||||||  ||||||||| |||||    
51873620 attaatttaatgttttatgtaccggtacactcaaaatgttggatgtaccatagaattt 51873677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 109 - 165
Target Start/End: Original strand, 24677898 - 24677954
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaatt 165  Q
    ||||||||||| |||| ||| || ||||||||||||||||| |||||||||| ||||    
24677898 attaatttaatgtttggtgtgccggtacactcaaaatgttgggtgtaccatagaatt 24677954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 109 - 172
Target Start/End: Original strand, 13216442 - 13216505
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatt 172  Q
    |||| |||||| |||| |||||| ||||||||||||||||  |||||||||| ||||| |||||    
13216442 attattttaatgtttggtgtaccggtacactcaaaatgttaggtgtaccatagaatttaccatt 13216505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 44978930 - 44978872
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||| |||| |||||| ||||||||||| ||||| |||||||||| |||||    
44978930 attaatttaataatttggtgtaccggtacactcaaattgttgggtgtaccatagaattt 44978872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 46282002 - 46281940
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    |||| |||||| |||| |||||| ||||||||||||| ||| |||||||||| ||||| ||||    
46282002 attattttaatgtttggtgtaccggtacactcaaaatattgggtgtaccatagaatttgccat 46281940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 120 - 166
Target Start/End: Complemental strand, 51984983 - 51984937
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||||| |||||||||| | |||||||||||||| |||||    
51984983 atttgatgtaccaatacactcaaattattgagtgtaccatagaattt 51984937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 173
Target Start/End: Complemental strand, 12227182 - 12227117
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccattt 173  Q
    |||||||||||  |||| |||||  ||||||||||||||||| |||||||||| ||||| ||||||    
12227182 attaatttaatgctttggtgtactggtacactcaaaatgttgggtgtaccatagaatttgccattt 12227117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 41568505 - 41568448
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||| |||||| |||| |||||| ||||||||||||| ||| |||||||||| |||||    
41568505 attattttaatgtttggtgtaccggtacactcaaaatattgggtgtaccatagaattt 41568448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 110 - 169
Target Start/End: Original strand, 17644897 - 17644957
Alignment:
110 ttaatttaat-atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttcc 169  Q
    |||||||||| ||||| |||| ||||||||||||||| |||| |||| |||| ||||||||    
17644897 ttaatttaatgatttggtgtatcagtacactcaaaattttgaatgtatcatagaattttcc 17644957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 120 - 172
Target Start/End: Complemental strand, 51369378 - 51369326
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatt 172  Q
    ||||| |||| || |||||||||| |||||||||||||||| ||||| |||||    
51369378 atttggtgtatcaatacactcaaattgttgagtgtaccatagaatttgccatt 51369326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 14)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 109 - 173
Target Start/End: Original strand, 17370622 - 17370686
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccattt 173  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| ||||| ||||||    
17370622 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaatttgccattt 17370686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 37992027 - 37992085
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||  ||||||||||| ||||||||||||||||| ||||||||||||||||    
37992027 attaatttaatgctttgatgtaccggtacactcaaaatgttgggtgtaccataaaattt 37992085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 1792173 - 1792230
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||| |||||||||||||| |||||    
1792173 attaatttaatgtttggtgtaccggtacactcaaaatattgagtgtaccatagaattt 1792230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 5474356 - 5474413
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| ||||||||||| ||| |||||||||||||  |||||||||||||||    
5474356 attaatttaatgtttgatgtaccggtatactcaaaatgttggatgtaccataaaattt 5474413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 48207138 - 48207081
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| |||||    
48207138 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 48207081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 52324312 - 52324370
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||  |||| |||||| ||||||||||||||||| ||||||||||||||||    
52324312 attaatttaatgctttggtgtaccggtacactcaaaatgttgggtgtaccataaaattt 52324370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 126 - 169
Target Start/End: Complemental strand, 47302439 - 47302396
Alignment:
126 tgtaccagtacactcaaaatgttgagtgtaccataaaattttcc 169  Q
    ||||||| |||||||||| | |||||||||||||||||||||||    
47302439 tgtaccaatacactcaaatttttgagtgtaccataaaattttcc 47302396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 121 - 166
Target Start/End: Complemental strand, 3690558 - 3690513
Alignment:
121 tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||| ||||||  ||||||||||||||||||||||||||| |||||    
3690558 tttggtgtaccgatacactcaaaatgttgagtgtaccatagaattt 3690513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 6882879 - 6882936
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||| ||| ||||||||| |||||||||| |||||    
6882879 attaatttaatgtttggtgtaccggtatacttaaaatgttgggtgtaccatagaattt 6882936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 25684440 - 25684497
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| |||||||||||||||||  |||| |||| |||||    
25684440 attaatttaatgtttggtgtaccggtacactcaaaatgttggatgtatcatagaattt 25684497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 48262622 - 48262565
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| ||||||  |||||||||||| || ||||||||||| |||||    
48262622 attaatttaatgtttggtgtaccgatacactcaaaattttaagtgtaccatagaattt 48262565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 134 - 166
Target Start/End: Original strand, 30168471 - 30168503
Alignment:
134 tacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||||||||||||||| ||||||||    
30168471 tacactcaaaatgttgagtgtaccttaaaattt 30168503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 112 - 171
Target Start/End: Original strand, 40438983 - 40439043
Alignment:
112 aatttaat-atttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    |||||||| ||||| |||||| ||||||||||| | |||||||||||||| ||||| ||||    
40438983 aatttaatgatttggtgtaccggtacactcaaatttttgagtgtaccatagaatttgccat 40439043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 126 - 166
Target Start/End: Original strand, 49286972 - 49287012
Alignment:
126 tgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||| ||||||||||| | ||||||||||||||||||||    
49286972 tgtaccggtacactcaaattattgagtgtaccataaaattt 49287012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 109 - 176
Target Start/End: Complemental strand, 47175527 - 47175460
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatttgaa 176  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| ||||| | |||||||    
47175527 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaatttgcaatttgaa 47175460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 20199407 - 20199345
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccat 171  Q
    ||||||||||| |||| |||||| ||||||||| |||||||||||||||||| ||||| ||||    
20199407 attaatttaatgtttggtgtaccggtacactcacaatgttgagtgtaccatagaatttgccat 20199345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 4521615 - 4521672
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||||||| |||||||||| |||||    
4521615 attaatttaatgtttggtgtaccggtacactcaaaatgttgggtgtaccatagaattt 4521672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 26001255 - 26001198
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| |||||| ||||||||||||| |||||||||||||| |||||    
26001255 attaatttaatgtttggtgtaccggtacactcaaaatattgagtgtaccatagaattt 26001198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 36790233 - 36790290
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| ||||||  ||||||||||||||||||||||||||| |||||    
36790233 attaatttaatgtttggtgtaccgatacactcaaaatgttgagtgtaccatagaattt 36790290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 39540731 - 39540674
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||  |||||||||||||||||||||||||||||  ||||||||| |||||    
39540731 attaatttaaagtttgatgtaccagtacactcaaaatgttggatgtaccatagaattt 39540674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 109 - 172
Target Start/End: Complemental strand, 24397434 - 24397371
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattttccatt 172  Q
    ||||||||||| |||| |||||| |||||||||||||||||  ||||||||| ||||| |||||    
24397434 attaatttaatgtttggtgtaccggtacactcaaaatgttggatgtaccatagaatttgccatt 24397371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 4663495 - 4663535
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccata 160  Q
    ||||||||||||| |||||||||||| ||||||||||||||    
4663495 atttgatgtaccaatacactcaaaattttgagtgtaccata 4663535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 112 - 166
Target Start/End: Original strand, 28146664 - 28146718
Alignment:
112 aatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||||| |||||  |||||||||||||||||  ||||||||| |||||    
28146664 aatttaatatttggtgtactggtacactcaaaatgttggatgtaccatagaattt 28146718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 51996763 - 51996821
Alignment:
109 attaatttaata-tttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||  ||||||||||  ||||||||||||||||| |||||||||| |||||    
51996763 attaatttaatgctttgatgtactggtacactcaaaatgttgggtgtaccatagaattt 51996821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 44568643 - 44568586
Alignment:
109 attaatttaatatttgatgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    ||||||||||| |||| ||||||  |||||||||||||||  |||||||||| |||||    
44568643 attaatttaatgtttggtgtaccgatacactcaaaatgttaggtgtaccatagaattt 44568586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 27079736 - 27079776
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccata 160  Q
    ||||| ||||||| |||||||||| ||||||||||||||||    
27079736 atttggtgtaccaatacactcaaattgttgagtgtaccata 27079776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 27082703 - 27082743
Alignment:
120 atttgatgtaccagtacactcaaaatgttgagtgtaccata 160  Q
    ||||| ||||||| |||||||||| ||||||||||||||||    
27082703 atttggtgtaccaatacactcaaattgttgagtgtaccata 27082743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 126 - 166
Target Start/End: Complemental strand, 214183 - 214143
Alignment:
126 tgtaccagtacactcaaaatgttgagtgtaccataaaattt 166  Q
    |||||||||||||||||| | |||||||||||||| |||||    
214183 tgtaccagtacactcaaatttttgagtgtaccatagaattt 214143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175872 times since January 2019
Visitors: 1577