View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-10 (Length: 263)

Name: J5-5-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-10
J5-5-10
[»] chr4 (2 HSPs)
chr4 (78-263)||(41826031-41826216)
chr4 (1-83)||(41826212-41826294)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 78 - 263
Target Start/End: Original strand, 41826031 - 41826216
Alignment:
78 attaatataattttcctgtacaatatgcatgtttacagtttcagatttgacacaagcatctctaatgcaatgggattaaaaacaatatggttaatactcg 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41826031 attaatataattttcctgtacaatatgcatgtttacagtttcagatttgacacaagcatctctaatgcaatgggattaaaaacaatatggttaatactcg 41826130  T
178 ttagttgttgtaatggctccaaggttgccatctaagaatatttactccgatgtaggaataatagttgtgtttttagagggttgaat 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41826131 ttagttgttgtaatggctccaaggttgccatctaagaatatttactccgatgtaggaataatagttgtgtttttagagggttgaat 41826216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 41826212 - 41826294
Alignment:
1 tgaatgactcattgagttaacgttgaagaaattaaagaacttagatttaaacccgaaggaattagtaaataataaatattaat 83  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41826212 tgaatgactcattgagttaacgttgaagaaattaaagaacttagatttaaacccgaaggaattagtaaataataaatattaat 41826294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 307773 times since January 2019
Visitors: 441