View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-11 (Length: 520)

Name: J5-5-11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-11
J5-5-11
[»] chr6 (2 HSPs)
chr6 (210-520)||(3134898-3135206)
chr6 (1-215)||(3134688-3134902)
[»] chr7 (1 HSPs)
chr7 (303-488)||(1928120-1928305)


Alignment Details
Target: chr6 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 210 - 520
Target Start/End: Complemental strand, 3135206 - 3134898
Alignment:
210 attaatggcattccaattctaacaatgtgaatatataatatcagaaacaaaacaagtaaaagaaaaatggcaagactaaaccaaataataatgcttactc 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3135206 attaatggcattccaattctaacaatgtgaatatataatatcagaaacaaaacaagtaaaagaaaaatggcaagactaaaccaaataataatgcttactc 3135107  T
310 cttgtgttcattatacaagtccctttcaagctttttccagcgggcatacatcaatagaaaaccctcactaccacaaggtaatccagcagctatacggtca 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3135106 cttgtgttcattatacaagtccctttcaagctttttccagcgggcatacatcaatagaaaaccctcactaccacaaggtaatccagcagctatacggtca 3135007  T
410 acatcaatatttgtcttaccaagggcttttgcttggtcataaggaggaatgatatcatataagcttctttctgtaagttgctcctccttcatcctttggc 509  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||    
3135006 acatcaatatttgtcttaccaagggcttttgcttggtcataaggaggaatgatatcatataagcttctttctgtaagttgctcct-cttcatccttt-gc 3134909  T
510 anggattttta 520  Q
    | |||||||||    
3134908 aaggattttta 3134898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 3134902 - 3134688
Alignment:
1 ttttacttgttcagtaaccttcttagtcagctttatctaggaaaaggcaaaattgagaaataaataaaagattaccaattaggcattttggtaggctaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3134902 ttttacttgttcagtaaccttcttagtcagctttatctaggaaaaggcaaaattgagaaataaataaaagattaccaattaggcattttggtaggctaga 3134803  T
101 tttacatgcttttaatcaagaacaatttaacgttttgttaatattgaaaatctagaatgaagaacaagaaattaggaaggaataactgatggagagaaca 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3134802 tttacatgcttttaatcaagaacaatttaacattttgttaatattgaaaatctagaatgaagaacaagaaattaggaaggaataactgatggagagaaca 3134703  T
201 ttatcctggattaat 215  Q
    |||||||||||||||    
3134702 ttatcctggattaat 3134688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 102; Significance: 2e-50; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 303 - 488
Target Start/End: Complemental strand, 1928305 - 1928120
Alignment:
303 cttactccttgtgttcattatacaagtccctttcaagctttttccagcgggcatacatcaatagaaaaccctcactaccacaaggtaatccagcagctat 402  Q
    ||||||||||  |||||||||||| ||| ||||||||||||||||| ||||||||||| || ||||| || ||||| ||||||||||| |||| ||||||    
1928305 cttactccttccgttcattatacaggtctctttcaagctttttccaccgggcatacattaagagaaacccttcacttccacaaggtaagccagaagctat 1928206  T
403 acggtcaacatcaatatttgtcttaccaagggcttttgcttggtcataaggaggaatgatatcatataagcttctttctgtaagtt 488  Q
    ||| |||||||||||||||||||| ||||| ||| |||||||||||||||||||||| | ||||||||||||  ||||||| ||||    
1928205 acgatcaacatcaatatttgtcttcccaagtgctcttgcttggtcataaggaggaataacatcatataagctagtttctgtcagtt 1928120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175946 times since January 2019
Visitors: 1577