View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-12 (Length: 298)

Name: J5-5-12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-12
J5-5-12
[»] chr1 (1 HSPs)
chr1 (3-289)||(23904645-23904931)


Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 3 - 289
Target Start/End: Complemental strand, 23904931 - 23904645
Alignment:
3 attaatctgattttcaaggaattgccatactctaatatcgttagatcttctagcagtcgaactgtggttcgtctcgtgtggaaccagccccatcctatag 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23904931 attaatctgattttcaaggaattgccatactctaatatcgttagatcttctagcagtcgaactgtggttcgtctcgtgtggaaccagccccatcctatag 23904832  T
103 acacaattgatgctggttgtgtctagcgaaatgagctatttccacaaaacactaattatcttgccttgtctagtttaccctcatatatatcagataagat 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
23904831 acacaattgatgctggttgtgtctagcgaaatgagctatttccacaaaacactaattatcttgtcttgtctagtttaccctcatatatatcagataagat 23904732  T
203 aaaatatagtacatattttgagggatgggacaaatagggtcaacaattctcaaataaacttgcttcataactataacacatgtcatt 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23904731 aaaatatagtacatattttgagggatgggacaaatagggtcaacaattctcaaataaacttgcttcataactataacacatgtcatt 23904645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 312162 times since January 2019
Visitors: 445