View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-5-12 (Length: 298)
Name: J5-5-12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-5-12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 3 - 289
Target Start/End: Complemental strand, 23904931 - 23904645
Alignment:
Q |
3 |
attaatctgattttcaaggaattgccatactctaatatcgttagatcttctagcagtcgaactgtggttcgtctcgtgtggaaccagccccatcctatag |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23904931 |
attaatctgattttcaaggaattgccatactctaatatcgttagatcttctagcagtcgaactgtggttcgtctcgtgtggaaccagccccatcctatag |
23904832 |
T |
 |
Q |
103 |
acacaattgatgctggttgtgtctagcgaaatgagctatttccacaaaacactaattatcttgccttgtctagtttaccctcatatatatcagataagat |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
23904831 |
acacaattgatgctggttgtgtctagcgaaatgagctatttccacaaaacactaattatcttgtcttgtctagtttaccctcatatatatcagataagat |
23904732 |
T |
 |
Q |
203 |
aaaatatagtacatattttgagggatgggacaaatagggtcaacaattctcaaataaacttgcttcataactataacacatgtcatt |
289 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23904731 |
aaaatatagtacatattttgagggatgggacaaatagggtcaacaattctcaaataaacttgcttcataactataacacatgtcatt |
23904645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 312162 times since January 2019
Visitors: 445