View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-15 (Length: 251)

Name: J5-5-15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-15
J5-5-15
[»] chr2 (2 HSPs)
chr2 (22-251)||(34011367-34011596)
chr2 (1-30)||(34011592-34011621)


Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 22 - 251
Target Start/End: Original strand, 34011367 - 34011596
Alignment:
22 aattaatcttaagacgaagggagtataaaccatgctcatttaatttagttgtcattgagccgcactaaggtacttgcgaataaattttcctaagttaagg 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34011367 aattaatcttaagacgaagggagtataaaccatgctcatttaatttagttgtcattgagccgcactaaggtacttgcgaataaattttcctaagttaagg 34011466  T
122 tgttctttaccgagcctaattatttcaaactgaactcactaaacactgatttgttagagatatctaagataaggtatagcaggtcattggtttattacaa 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34011467 tgttctttaccgagcctaattatttcaaactgaactcactaaacactgatttgttagagatatctaagataaggtatagcaggtcattggtttattacaa 34011566  T
222 atttacaaccaatcatagcatgcttttaac 251  Q
    ||||||||||||||||||||||||||||||    
34011567 atttacaaccaatcatagcatgcttttaac 34011596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 34011592 - 34011621
Alignment:
1 ttaacaataccaaagattatgaattaatct 30  Q
    ||||||||||||||||||||||||||||||    
34011592 ttaacaataccaaagattatgaattaatct 34011621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202086 times since January 2019
Visitors: 1513