View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-16 (Length: 587)

Name: J5-5-16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-16
J5-5-16
[»] chr3 (42 HSPs)
chr3 (312-586)||(13900604-13900878)
chr3 (118-318)||(13900192-13900392)
chr3 (1-79)||(13900431-13900509)
chr3 (130-197)||(105444-105511)
chr3 (207-280)||(36571377-36571449)
chr3 (208-276)||(2128428-2128495)
chr3 (125-278)||(4190633-4190773)
chr3 (210-277)||(42787621-42787687)
chr3 (131-277)||(611587-611720)
chr3 (208-275)||(4190695-4190761)
chr3 (207-278)||(36566701-36566771)
chr3 (221-278)||(105376-105432)
chr3 (212-281)||(12744972-12745040)
chr3 (221-278)||(41349740-41349797)
chr3 (226-275)||(42787700-42787748)
chr3 (226-278)||(331883-331934)
chr3 (212-268)||(4980287-4980342)
chr3 (215-267)||(4980347-4980398)
chr3 (226-278)||(10872757-10872808)
chr3 (211-250)||(7672763-7672802)
chr3 (209-276)||(10841703-10841769)
chr3 (221-276)||(22496957-22497011)
chr3 (208-275)||(39836932-39836998)
chr3 (221-280)||(50603593-50603651)
chr3 (226-268)||(1086594-1086635)
chr3 (228-278)||(12708692-12708741)
chr3 (220-278)||(21217170-21217227)
chr3 (226-280)||(29241565-29241618)
chr3 (227-281)||(40470419-40470472)
chr3 (221-278)||(24075451-24075507)
chr3 (212-281)||(24722688-24722756)
chr3 (221-278)||(26367475-26367531)
chr3 (221-278)||(40639789-40639845)
chr3 (221-278)||(48191719-48191775)
chr3 (221-278)||(52931645-52931701)
chr3 (221-278)||(54595794-54595850)
chr3 (226-278)||(7882285-7882336)
chr3 (226-278)||(12744905-12744956)
chr3 (221-281)||(36344453-36344513)
chr3 (221-277)||(42449110-42449165)
chr3 (128-196)||(42929004-42929072)
chr3 (206-250)||(43493823-43493867)
[»] chr2 (42 HSPs)
chr2 (125-197)||(27964279-27964351)
chr2 (126-275)||(41824268-41824404)
chr2 (208-278)||(44274608-44274677)
chr2 (212-275)||(18731341-18731404)
chr2 (212-281)||(15119778-15119846)
chr2 (211-280)||(45472412-45472480)
chr2 (210-278)||(44274546-44274613)
chr2 (207-278)||(41824326-41824396)
chr2 (222-277)||(43714129-43714183)
chr2 (222-284)||(2544349-2544410)
chr2 (221-287)||(14952845-14952910)
chr2 (231-281)||(43100750-43100799)
chr2 (221-278)||(3123983-3124039)
chr2 (233-278)||(15446783-15446827)
chr2 (229-278)||(26229533-26229581)
chr2 (221-278)||(26836235-26836291)
chr2 (209-278)||(27964288-27964356)
chr2 (208-281)||(44094867-44094939)
chr2 (212-276)||(20218617-20218680)
chr2 (221-276)||(11726575-11726629)
chr2 (213-280)||(15446850-15446916)
chr2 (215-278)||(27331833-27331895)
chr2 (211-278)||(32316422-32316488)
chr2 (221-276)||(34248421-34248475)
chr2 (220-278)||(3098205-3098262)
chr2 (125-195)||(23143561-23143631)
chr2 (125-195)||(23555351-23555421)
chr2 (220-278)||(25270935-25270992)
chr2 (123-197)||(26229518-26229592)
chr2 (221-283)||(38181759-38181820)
chr2 (220-278)||(41056967-41057024)
chr2 (212-277)||(1961380-1961444)
chr2 (221-278)||(10221976-10222032)
chr2 (212-277)||(15916738-15916802)
chr2 (125-178)||(30429064-30429117)
chr2 (221-278)||(31024175-31024231)
chr2 (123-196)||(44274615-44274688)
chr2 (215-275)||(3887840-3887899)
chr2 (226-278)||(23143571-23143622)
chr2 (226-278)||(23555361-23555412)
chr2 (215-275)||(41056895-41056954)
chr2 (125-197)||(44587638-44587710)
[»] chr7 (48 HSPs)
chr7 (131-279)||(11602769-11602904)
chr7 (122-278)||(8169089-8169232)
chr7 (210-277)||(37491278-37491344)
chr7 (208-278)||(34840618-34840687)
chr7 (212-278)||(43813129-43813194)
chr7 (124-197)||(34840734-34840807)
chr7 (208-276)||(21099310-21099377)
chr7 (212-280)||(25768690-25768757)
chr7 (212-276)||(25774253-25774316)
chr7 (125-250)||(32599694-32599807)
chr7 (221-278)||(10095723-10095779)
chr7 (212-281)||(23797349-23797417)
chr7 (221-278)||(31417597-31417653)
chr7 (208-273)||(38940286-38940350)
chr7 (214-278)||(785625-785688)
chr7 (221-281)||(2943213-2943272)
chr7 (226-278)||(34478320-34478371)
chr7 (226-278)||(34703528-34703579)
chr7 (226-278)||(40416991-40417042)
chr7 (231-278)||(4132390-4132437)
chr7 (226-281)||(28752164-28752218)
chr7 (208-275)||(30457797-30457863)
chr7 (212-275)||(31319587-31319649)
chr7 (211-278)||(36547656-36547722)
chr7 (211-278)||(43103076-43103142)
chr7 (220-278)||(7701192-7701249)
chr7 (212-278)||(8595151-8595216)
chr7 (215-277)||(21387581-21387642)
chr7 (247-281)||(26982765-26982799)
chr7 (125-191)||(34840609-34840675)
chr7 (208-278)||(38940224-38940293)
chr7 (212-273)||(6250671-6250732)
chr7 (229-278)||(18654254-18654302)
chr7 (221-278)||(25245223-25245279)
chr7 (125-174)||(35274508-35274557)
chr7 (129-178)||(43813124-43813173)
chr7 (211-247)||(1548849-1548885)
chr7 (125-193)||(2456331-2456399)
chr7 (221-277)||(4406422-4406477)
chr7 (226-278)||(5950279-5950330)
chr7 (226-278)||(8127912-8127963)
chr7 (221-277)||(12274814-12274869)
chr7 (129-197)||(18654545-18654613)
chr7 (124-156)||(21857063-21857095)
chr7 (226-278)||(21886471-21886522)
chr7 (226-282)||(27330593-27330648)
chr7 (226-278)||(31813415-31813466)
chr7 (226-278)||(41404019-41404070)
[»] chr5 (56 HSPs)
chr5 (125-277)||(7313836-7313975)
chr5 (208-284)||(27895895-27895970)
chr5 (208-278)||(40100153-40100223)
chr5 (209-278)||(13654576-13654644)
chr5 (212-275)||(3100412-3100474)
chr5 (208-278)||(1098694-1098763)
chr5 (125-275)||(1098635-1098772)
chr5 (221-277)||(43506174-43506229)
chr5 (208-278)||(7313897-7313966)
chr5 (221-279)||(11262331-11262388)
chr5 (208-278)||(25713765-25713834)
chr5 (125-178)||(8717799-8717852)
chr5 (125-206)||(18261595-18261676)
chr5 (229-278)||(18261604-18261652)
chr5 (221-278)||(25408547-25408603)
chr5 (221-278)||(25792926-25792982)
chr5 (212-277)||(32911563-32911628)
chr5 (221-278)||(37944606-37944662)
chr5 (221-278)||(42013826-42013882)
chr5 (125-185)||(13391616-13391676)
chr5 (208-288)||(13654503-13654582)
chr5 (226-278)||(25358062-25358113)
chr5 (127-195)||(25792921-25792989)
chr5 (213-281)||(36895308-36895375)
chr5 (221-277)||(43506112-43506167)
chr5 (231-278)||(892555-892601)
chr5 (215-278)||(6763771-6763833)
chr5 (128-195)||(13654507-13654574)
chr5 (127-178)||(17225159-17225210)
chr5 (221-280)||(37944682-37944740)
chr5 (227-278)||(40515231-40515281)
chr5 (211-273)||(238796-238857)
chr5 (221-275)||(19531381-19531434)
chr5 (219-277)||(36759438-36759495)
chr5 (221-275)||(36864502-36864555)
chr5 (209-275)||(40100094-40100159)
chr5 (212-281)||(2673848-2673916)
chr5 (221-278)||(3851443-3851499)
chr5 (227-276)||(9707091-9707139)
chr5 (221-278)||(11262408-11262464)
chr5 (221-278)||(13356217-13356273)
chr5 (221-278)||(19531305-19531361)
chr5 (211-284)||(22227051-22227123)
chr5 (221-278)||(23914845-23914901)
chr5 (132-197)||(25713771-25713836)
chr5 (221-278)||(26300115-26300171)
chr5 (212-277)||(33075136-33075200)
chr5 (237-278)||(40515277-40515317)
chr5 (221-278)||(42013902-42013958)
chr5 (226-278)||(71263-71314)
chr5 (125-197)||(2673842-2673914)
chr5 (226-274)||(4082823-4082870)
chr5 (130-178)||(13356106-13356154)
chr5 (221-277)||(17967395-17967450)
chr5 (226-278)||(25776989-25777040)
chr5 (130-178)||(40515227-40515275)
[»] chr4 (79 HSPs)
chr4 (125-281)||(11796580-11796723)
chr4 (221-277)||(22020121-22020176)
chr4 (208-275)||(5535721-5535787)
chr4 (210-277)||(15659940-15660006)
chr4 (125-277)||(37255677-37255816)
chr4 (207-281)||(37255683-37255756)
chr4 (125-178)||(3094358-3094411)
chr4 (221-278)||(19934642-19934698)
chr4 (221-278)||(29006839-29006895)
chr4 (221-278)||(54164817-54164873)
chr4 (221-278)||(54164893-54164949)
chr4 (129-196)||(20215566-20215633)
chr4 (217-275)||(3504084-3504141)
chr4 (208-278)||(3740375-3740444)
chr4 (233-283)||(13689628-13689677)
chr4 (208-250)||(16912470-16912512)
chr4 (221-275)||(19934718-19934771)
chr4 (221-275)||(26636520-26636573)
chr4 (208-278)||(26909668-26909737)
chr4 (226-284)||(46518505-46518562)
chr4 (221-283)||(54106474-54106535)
chr4 (208-273)||(2254020-2254084)
chr4 (221-278)||(20215571-20215627)
chr4 (220-281)||(28815862-28815922)
chr4 (221-278)||(29006915-29006971)
chr4 (224-281)||(41905870-41905926)
chr4 (212-277)||(52914069-52914133)
chr4 (221-278)||(55936067-55936123)
chr4 (130-178)||(3740400-3740448)
chr4 (207-275)||(5535779-5535846)
chr4 (211-251)||(17657977-17658017)
chr4 (129-197)||(19934637-19934705)
chr4 (221-277)||(24941116-24941171)
chr4 (215-283)||(31262668-31262735)
chr4 (129-197)||(54164812-54164880)
chr4 (229-276)||(9993532-9993578)
chr4 (208-279)||(11796588-11796658)
chr4 (126-197)||(15659931-15660002)
chr4 (211-278)||(20788105-20788171)
chr4 (228-283)||(31280332-31280386)
chr4 (229-276)||(35005143-35005189)
chr4 (226-276)||(3094273-3094322)
chr4 (212-278)||(3094337-3094402)
chr4 (208-250)||(4386389-4386431)
chr4 (210-276)||(6087502-6087567)
chr4 (228-278)||(20788040-20788089)
chr4 (212-250)||(21586989-21587027)
chr4 (125-191)||(22020111-22020177)
chr4 (212-278)||(22720577-22720642)
chr4 (211-277)||(24851416-24851481)
chr4 (129-195)||(54164888-54164954)
chr4 (207-276)||(4386329-4386397)
chr4 (221-278)||(5281215-5281271)
chr4 (221-274)||(6462792-6462844)
chr4 (228-277)||(12927114-12927162)
chr4 (124-197)||(16912433-16912506)
chr4 (226-271)||(19595523-19595567)
chr4 (125-166)||(29588484-29588525)
chr4 (221-278)||(38381980-38382036)
chr4 (221-250)||(41459494-41459523)
chr4 (247-280)||(52673703-52673736)
chr4 (221-278)||(52817647-52817703)
chr4 (221-278)||(54106555-54106611)
chr4 (231-276)||(54338916-54338960)
chr4 (125-197)||(4386318-4386390)
chr4 (221-281)||(5418516-5418575)
chr4 (221-275)||(18626716-18626767)
chr4 (226-278)||(20598261-20598312)
chr4 (226-278)||(22235345-22235396)
chr4 (226-278)||(23568465-23568516)
chr4 (211-251)||(25700527-25700567)
chr4 (134-174)||(28815879-28815919)
chr4 (129-197)||(33694042-33694110)
chr4 (136-196)||(35005129-35005189)
chr4 (212-280)||(36869974-36870042)
chr4 (221-281)||(40814749-40814808)
chr4 (207-251)||(44171464-44171508)
chr4 (221-249)||(52674897-52674925)
chr4 (226-278)||(54713102-54713153)
[»] chr8 (33 HSPs)
chr8 (123-269)||(24418874-24419007)
chr8 (227-277)||(6260694-6260744)
chr8 (207-280)||(13841850-13841922)
chr8 (221-278)||(24820377-24820433)
chr8 (209-250)||(36308059-36308100)
chr8 (221-277)||(24820303-24820358)
chr8 (221-275)||(7377634-7377688)
chr8 (212-277)||(5888341-5888405)
chr8 (211-276)||(17871833-17871897)
chr8 (221-278)||(29424063-29424119)
chr8 (221-273)||(7428901-7428952)
chr8 (226-278)||(10117055-10117106)
chr8 (226-278)||(15037835-15037887)
chr8 (221-277)||(26014574-26014629)
chr8 (226-278)||(36698715-36698766)
chr8 (221-276)||(7410571-7410625)
chr8 (211-278)||(13841917-13841984)
chr8 (211-277)||(13964424-13964489)
chr8 (208-278)||(24418885-24418954)
chr8 (129-278)||(28882668-28882805)
chr8 (221-278)||(1739645-1739701)
chr8 (211-284)||(2627244-2627316)
chr8 (221-278)||(7377558-7377614)
chr8 (221-278)||(9056025-9056081)
chr8 (221-278)||(9056101-9056157)
chr8 (221-278)||(10934683-10934739)
chr8 (221-278)||(14381242-14381298)
chr8 (129-194)||(28882663-28882728)
chr8 (161-214)||(32241779-32241832)
chr8 (213-250)||(37036141-37036178)
chr8 (226-275)||(37288563-37288612)
chr8 (221-278)||(40098840-40098896)
chr8 (225-277)||(4613643-4613694)
[»] chr1 (83 HSPs)
chr1 (210-290)||(10256773-10256852)
chr1 (227-278)||(5431345-5431395)
chr1 (161-276)||(6340590-6340704)
chr1 (208-278)||(1409116-1409185)
chr1 (217-278)||(1035963-1036023)
chr1 (210-278)||(38834615-38834682)
chr1 (207-275)||(39940552-39940619)
chr1 (221-284)||(5431420-5431482)
chr1 (221-280)||(34597522-34597580)
chr1 (211-278)||(47446701-47446767)
chr1 (210-277)||(52112881-52112947)
chr1 (131-278)||(34768283-34768417)
chr1 (207-280)||(36164023-36164097)
chr1 (210-280)||(42660424-42660493)
chr1 (221-278)||(52923327-52923383)
chr1 (121-276)||(6340565-6340719)
chr1 (221-276)||(19175668-19175722)
chr1 (124-191)||(19580272-19580339)
chr1 (229-283)||(1741608-1741661)
chr1 (228-278)||(14214554-14214603)
chr1 (221-283)||(19175587-19175648)
chr1 (208-278)||(19580260-19580329)
chr1 (226-280)||(27939189-27939242)
chr1 (129-195)||(52923322-52923388)
chr1 (211-276)||(1602887-1602951)
chr1 (211-276)||(2122639-2122703)
chr1 (221-278)||(8258023-8258079)
chr1 (221-278)||(14214609-14214665)
chr1 (221-278)||(23944041-23944097)
chr1 (213-250)||(24807963-24808000)
chr1 (208-277)||(42915652-42915720)
chr1 (208-277)||(42915713-42915781)
chr1 (221-277)||(6079143-6079198)
chr1 (221-277)||(52923403-52923458)
chr1 (237-280)||(1409051-1409093)
chr1 (221-268)||(8984268-8984314)
chr1 (210-281)||(9676035-9676105)
chr1 (221-280)||(13288414-13288472)
chr1 (221-268)||(34597593-34597639)
chr1 (215-278)||(37734847-37734909)
chr1 (226-273)||(42660366-42660412)
chr1 (215-281)||(2349830-2349896)
chr1 (123-197)||(5431413-5431487)
chr1 (208-282)||(9902634-9902707)
chr1 (131-197)||(19175589-19175655)
chr1 (215-277)||(24981846-24981907)
chr1 (220-278)||(24981920-24981977)
chr1 (229-275)||(32796834-32796879)
chr1 (208-270)||(36163970-36164031)
chr1 (225-275)||(46412710-46412759)
chr1 (220-278)||(46906865-46906922)
chr1 (226-276)||(51022723-51022772)
chr1 (125-174)||(457668-457717)
chr1 (221-278)||(639803-639859)
chr1 (221-278)||(3384227-3384283)
chr1 (228-277)||(3906848-3906896)
chr1 (226-275)||(6156641-6156689)
chr1 (129-178)||(14214549-14214598)
chr1 (212-277)||(20273191-20273255)
chr1 (221-278)||(24807894-24807951)
chr1 (125-174)||(30412592-30412641)
chr1 (221-278)||(33604071-33604127)
chr1 (226-275)||(34953981-34954029)
chr1 (221-278)||(35367558-35367614)
chr1 (221-278)||(37734777-37734833)
chr1 (124-173)||(38758397-38758446)
chr1 (125-178)||(42915642-42915695)
chr1 (221-278)||(48022599-48022655)
chr1 (212-277)||(48083509-48083573)
chr1 (226-278)||(3013695-3013746)
chr1 (125-177)||(4604833-4604885)
chr1 (221-281)||(12750562-12750621)
chr1 (226-278)||(18353657-18353708)
chr1 (211-283)||(18551331-18551402)
chr1 (227-275)||(18854985-18855033)
chr1 (226-278)||(23398423-23398474)
chr1 (226-274)||(26158716-26158763)
chr1 (226-274)||(26172014-26172061)
chr1 (226-278)||(26937865-26937916)
chr1 (226-278)||(27864504-27864555)
chr1 (212-276)||(34953902-34953965)
chr1 (226-270)||(43318093-43318136)
chr1 (129-197)||(52112875-52112943)
[»] chr6 (31 HSPs)
chr6 (229-284)||(32124212-32124266)
chr6 (125-182)||(3203666-3203723)
chr6 (125-194)||(31632183-31632252)
chr6 (211-278)||(3203675-3203741)
chr6 (208-275)||(15718460-15718526)
chr6 (128-183)||(18491748-18491803)
chr6 (212-277)||(14173395-14173459)
chr6 (212-277)||(14177931-14177995)
chr6 (226-278)||(8449661-8449712)
chr6 (226-278)||(8458465-8458516)
chr6 (212-276)||(18886314-18886377)
chr6 (221-268)||(3012440-3012486)
chr6 (221-280)||(5085339-5085398)
chr6 (207-278)||(13462937-13463007)
chr6 (212-283)||(15517161-15517231)
chr6 (226-284)||(16120963-16121020)
chr6 (211-273)||(18491670-18491731)
chr6 (221-275)||(26527270-26527323)
chr6 (211-277)||(30422338-30422403)
chr6 (210-275)||(8449581-8449645)
chr6 (210-275)||(8458385-8458449)
chr6 (221-278)||(13276490-13276546)
chr6 (208-273)||(13462999-13463063)
chr6 (226-275)||(16121050-16121098)
chr6 (221-278)||(21506467-21506523)
chr6 (221-278)||(30397804-30397860)
chr6 (221-278)||(34379815-34379871)
chr6 (221-281)||(4844290-4844349)
chr6 (221-273)||(11745932-11745984)
chr6 (221-277)||(17773506-17773561)
chr6 (132-176)||(24110222-24110266)
[»] scaffold1640 (1 HSPs)
scaffold1640 (212-280)||(1139-1206)
[»] scaffold0149 (1 HSPs)
scaffold0149 (212-278)||(24677-24742)
[»] scaffold0059 (1 HSPs)
scaffold0059 (211-278)||(4443-4509)
[»] scaffold0148 (1 HSPs)
scaffold0148 (211-273)||(21191-21252)
[»] scaffold0536 (1 HSPs)
scaffold0536 (228-277)||(4037-4085)
[»] scaffold0047 (1 HSPs)
scaffold0047 (221-278)||(61167-61223)
[»] scaffold0024 (2 HSPs)
scaffold0024 (221-278)||(120149-120205)
scaffold0024 (221-278)||(120225-120281)
[»] scaffold0007 (1 HSPs)
scaffold0007 (221-277)||(246800-246855)


Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-125; HSPs: 42)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 312 - 586
Target Start/End: Complemental strand, 13900878 - 13900604
Alignment:
312 attaataatgtatgatattattattattgcaatagatgagaaattgtagattatgctgatgaattcaaattgatgccaaccacgtattctttatattgtc 411  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13900878 attaataatgtatgatattattattattgcaatagatgagaaattgtagattatgctgatgaattcaaattgatgccaaccacgtattctttatattgtc 13900779  T
412 ttccttcaaaggcaagaaaacaggttagtgcttatgtgatgaaaatatattatctttgtcccaatcatgtactattttaagtattataattcccttagtg 511  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
13900778 ttccttcaaaggcaagaaaacaggttagtgcttatgtgatgaaaatatattatctttgtcccaatcatgtactattttaagtattataatt-ccttagtg 13900680  T
512 cccacttgtactaatcaatcntaccccagatatgtctt-nnnnnnntattcccatgatatatgtatgaatatgtgc 586  Q
    |||||||||||||||||||| ||||| |||||||||||        |||||| |||||||||||||||||||||||    
13900679 cccacttgtactaatcaatcatacccaagatatgtcttaaaaaaaatattccaatgatatatgtatgaatatgtgc 13900604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 118 - 318
Target Start/End: Complemental strand, 13900392 - 13900192
Alignment:
118 ggaattgtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatataga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13900392 ggaattgtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatataga 13900293  T
218 ctgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagagaataattgactaaagtttttgttgcataattaat 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13900292 ctgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagagaataattgactaaagtttttgttgcataattaat 13900193  T
318 a 318  Q
    |    
13900192 a 13900192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 13900509 - 13900431
Alignment:
1 atatcccgtcgagaaaaatgttcatattttgtatttgacagtatcctcaataagattaactcctatgggaagaatctat 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13900509 atatcccgtcgagaaaaatgttcatattttgtatttgacagtatcctcaataagattaactcctatgggaagaatctat 13900431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 130 - 197
Target Start/End: Complemental strand, 105511 - 105444
Alignment:
130 cctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||||||||||||||||||||||||| || ||||||||||||||||||  ||||| |||||||||||    
105511 cctccggtcacttttataagcaaaagttgactttttaggttcattcaatacattatgtatgtggtcta 105444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 207 - 280
Target Start/End: Complemental strand, 36571449 - 36571377
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    ||||||||||||| |||| |||||||||||||| ||||||||||||  || |||||||||||||||||||||||    
36571449 ttatatatagactacatacatcatttattgaataaatctaaaaaag-aaacttttgcttataatagtgaccgaa 36571377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 208 - 276
Target Start/End: Original strand, 2128428 - 2128495
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||||||  |||| |||||||||||||||||||||||| | ||||||||||||||||||||||||    
2128428 tatatatagaccacatacatcatttattgaatgaatctaaaaca-tgaatttttgcttataatagtgac 2128495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 125 - 278
Target Start/End: Complemental strand, 4190773 - 4190633
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcata 224  Q
    ||||||||||  ||||| |||||||||||||| || |||||||||||||||||| ||| || |||| ||||||            ||||||| || ||||    
4190773 tactccctcctatcactattataagcaaaagttgactttttaggttcattcaataaatgatgtatgaggtcta------------tatataggctacata 4190686  T
225 aatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
     || |||||||||||||| |||||||| ||||||||| ||||||||||||||||    
4190685 cataatttattgaatgaaactaaaaaa-tgaattttttcttataatagtgaccg 4190633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 210 - 277
Target Start/End: Complemental strand, 42787687 - 42787621
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||||| |||| ||||||||||||||| ||||| |||| || ||||||||||||||||||||||    
42787687 tatatagactacatatatcatttattgaatggatctacaaaattg-atttttgcttataatagtgacc 42787621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 131 - 277
Target Start/End: Complemental strand, 611720 - 611587
Alignment:
131 ctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcataaatcat 230  Q
    ||||||||||| |||||||||||||| || |||||||||| ||||| | ||| || |||||||||            |||||||||||| |||| |||||    
611720 ctccggtcactattataagcaaaagttgactttttaggttaattcattaaataatgtatgtggtc------------tatatatagactacatacatcat 611633  T
231 ttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||||||| |||||||||||   || |||| |||||||||||||||    
611632 ttattgaattaatctaaaaaa-caaacttttacttataatagtgacc 611587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 208 - 275
Target Start/End: Original strand, 4190695 - 4190761
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||||||  |||| ||||||||||||||||| || ||||||| || ||||||||||||||||||    
4190695 tatatatagacctcatacatcatttattgaatgaacct-aaaaagtcaacttttgcttataatagtga 4190761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 207 - 278
Target Start/End: Original strand, 36566701 - 36566771
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||| || | || |||||||||||||||||||| ||||||  || |||||||||||||||||||||    
36566701 ttatatatagcctacctacatcatttattgaatgaatct-aaaaagaaaacttttgcttataatagtgaccg 36566771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 105432 - 105376
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||| |||||||||||||| ||||||||||| ||| |||||||||||    
105432 catacatcatttattcaatgaatctaaaaa-gtgaatttttgtttacaatagtgaccg 105376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 212 - 281
Target Start/End: Original strand, 12744972 - 12745040
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||||||  |||| |||||||| |||||| ||||||||  || |||||||||||||||||||||||||||    
12744972 tatagaccacatacatcatttaatgaatgtatctaaaat-gttaatttttgcttataatagtgaccgaag 12745040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 41349740 - 41349797
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| |||||||||| || ||||||||||||| |||||||||    
41349740 catacatcattaattgaatgtatctaaaaaaatggatttttgcttatattagtgaccg 41349797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 226 - 275
Target Start/End: Original strand, 42787700 - 42787748
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||||||||||||||| |||||||| |||||||||| ||||||||||||    
42787700 atcatttattgaatgaacctaaaaaa-tgaatttttgtttataatagtga 42787748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 331883 - 331934
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| |||||||||||||||  || ||||||||||||||||||||||||    
331883 atcatttaatgaatgaatctaaaat-gttaatttttgcttataatagtgaccg 331934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 212 - 268
Target Start/End: Complemental strand, 4980342 - 4980287
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttata 268  Q
    |||||||  |||| |||||||||||||||||||||||| | ||||||||||||||||    
4980342 tatagacaacatatatcatttattgaatgaatctaaaata-tgaatttttgcttata 4980287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 215 - 267
Target Start/End: Original strand, 4980347 - 4980398
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttat 267  Q
    ||||| |||| |||||||||||||||||||||||| | |||||||||||||||    
4980347 agactacatacatcatttattgaatgaatctaaaata-tgaatttttgcttat 4980398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 10872757 - 10872808
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| ||||||||||||||||| | | ||||||||||||||||||||||||    
10872757 atcattaattgaatgaatctaaaata-taaatttttgcttataatagtgaccg 10872808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 211 - 250
Target Start/End: Original strand, 7672763 - 7672802
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaa 250  Q
    ||||||||| ||||||||||| ||||||||||||||||||    
7672763 atatagactacataaatcattaattgaatgaatctaaaaa 7672802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 209 - 276
Target Start/End: Complemental strand, 10841769 - 10841703
Alignment:
209 atatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    ||||||||||  |||| | |||||||||||||||||| || | || ||||||||||||||||||||||    
10841769 atatatagaccacatacaacatttattgaatgaatct-aatacgtaaatttttgcttataatagtgac 10841703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 22497011 - 22496957
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||| |||||||| ||||||||||||||| | | ||||||||||||||||||||||    
22497011 catacatcatttaatgaatgaatctaaaatatt-aatttttgcttataatagtgac 22496957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 208 - 275
Target Start/End: Original strand, 39836932 - 39836998
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||||||  |||| |||||||||||||||||||| ||||||| || ||||  ||||||||||||    
39836932 tatatatagaccacatacatcatttattgaatgaatct-aaaaagtaaacttttatttataatagtga 39836998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 280
Target Start/End: Original strand, 50603593 - 50603651
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||| |||||||||||||||||  |||||||  || ||||||||||||||||||||||||    
50603593 catacatcatttattgaatgaacttaaaaaataga-tttttgcttataatagtgaccgaa 50603651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 1086594 - 1086635
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttata 268  Q
    |||||||||||||||||||| ||||||||||||||| ||||||    
1086594 atcatttattgaatgaatct-aaaaagtgaatttttacttata 1086635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 228 - 278
Target Start/End: Complemental strand, 12708741 - 12708692
Alignment:
228 catttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||||||| ||| |||| ||||||||||||||||||||||||||    
12708741 catttaatgaatgaacctagaaaa-tgaatttttgcttataatagtgaccg 12708692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 220 - 278
Target Start/End: Complemental strand, 21217227 - 21217170
Alignment:
220 gcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||| |||||||||||||||  ||  |||||||||||||||||||||||    
21217227 gcatacatcatttaatgaatgaatctaaaat-gtagatttttgcttataatagtgaccg 21217170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 226 - 280
Target Start/End: Original strand, 29241565 - 29241618
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||||||||||||||||||| |||||||  ||||| |||||||||| ||||||||    
29241565 atcatttattgaatgaatct-aaaaagttgattttggcttataataatgaccgaa 29241618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 227 - 281
Target Start/End: Complemental strand, 40470472 - 40470419
Alignment:
227 tcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    ||||||| ||||||||||||||||  | |||||||||||||| ||||||||||||    
40470472 tcatttaatgaatgaatctaaaaat-taaatttttgcttatattagtgaccgaag 40470419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 24075507 - 24075451
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||| |||||||||||||||   ||  ||||||||||||||||||||||    
24075507 cataaatcatttaatgaatgaatctaaaatgttgt-tttttgcttataatagtgaccg 24075451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 281
Target Start/End: Complemental strand, 24722756 - 24722688
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||||||  |||| |||||||| | ||||||||||||| | | |||||||||||||||||||||| ||||    
24722756 tatagaccacatacatcatttaataaatgaatctaaaatatt-aatttttgcttataatagtgactgaag 24722688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 26367531 - 26367475
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||||||||| | || ||||||||||||| | |||||||    
26367531 catacatcatttattgaatgaatctaaaaca-tggatttttgcttatatttgtgaccg 26367475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 40639789 - 40639845
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| ||||||||| |||||  || ||||||||||||||||||||||||    
40639789 catacatcatttaatgaatgaatttaaaat-gttaatttttgcttataatagtgaccg 40639845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 48191775 - 48191719
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| ||||||||||| |||| || |||||||| |||||||||||||||    
48191775 catacatcatttaatgaatgaatct-aaaatgttaatttttgtttataatagtgaccg 48191719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 52931701 - 52931645
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||| || |||||||||||||||| |||||||||    
52931701 catacatcattaattgaatgtatctaaagaa-tgaatttttgcttatattagtgaccg 52931645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 54595850 - 54595794
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| |||||||||||||||   ||| ||||||||||||||||||||||    
54595850 catacatcatttaatgaatgaatctaaaatgttga-tttttgcttataatagtgaccg 54595794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 7882336 - 7882285
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| | |||||||||||||  || ||||||||||||||||||||||||    
7882336 atcatttaattaatgaatctaaaat-gttaatttttgcttataatagtgaccg 7882285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 12744956 - 12744905
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||||||||||||||||  || | ||||||||||||||||||||||    
12744956 atcattaattgaatgaatctaaaat-gtaagtttttgcttataatagtgaccg 12744905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 281
Target Start/End: Original strand, 36344453 - 36344513
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||| |||||||| ||||||||||||||| |   ||||||| ||||||||||||| |||||    
36344453 catacatcatttaatgaatgaatctaaaatacaaaatttttacttataatagtgatcgaag 36344513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 42449165 - 42449110
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||| |||||||| ||||||||| ||| ||||||||||||| ||||||||    
42449165 catacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgacc 42449110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 128 - 196
Target Start/End: Original strand, 42929004 - 42929072
Alignment:
128 tccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtct 196  Q
    |||||||||||||| |||||||||||| |  || |||||  |||||||||| ||| || ||||||||||    
42929004 tccctccggtcactattataagcaaaattctaaattttatattcattcaattaatgatctatgtggtct 42929072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 43493867 - 43493823
Alignment:
206 attatatatagactgcataaatcatttattgaatgaatctaaaaa 250  Q
    |||||||||||||  |||| |||||||||| ||||||||||||||    
43493867 attatatatagaccacatacatcatttattaaatgaatctaaaaa 43493823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 4e-21; HSPs: 42)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 125 - 197
Target Start/End: Original strand, 27964279 - 27964351
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    |||||||||||||||||||||||||||||| | || |||||||||||||||||| |||||| |||||||||||    
27964279 tactccctccggtcacttttataagcaaaaattgactttttaggttcattcaataaattatgtatgtggtcta 27964351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 126 - 275
Target Start/End: Complemental strand, 41824404 - 41824268
Alignment:
126 actccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcataa 225  Q
    ||||||||||||||||  |||||| |||| | || |||||||||||||||||| ||| || |||||||||||            |||||| ||| ||||     
41824404 actccctccggtcactactataagtaaaaattgactttttaggttcattcaataaatgatgtatgtggtcta------------tatataaactacatac 41824317  T
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    || ||||||||||||||||||||||| |||||||||||||||||||||||    
41824316 ataatttattgaatgaatctaaaaaa-tgaatttttgcttataatagtga 41824268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 44274608 - 44274677
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| ||||| |||| |||||||||||||||||||| ||||||||||||||||||||||  ||||||||    
44274608 tatatacagactacatacatcatttattgaatgaatct-aaaaagtgaatttttgcttatatcagtgaccg 44274677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 18731341 - 18731404
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||| |||| || |||||||||||||||||||||||  ||| ||||||||||||||||||    
18731341 tatagactacatacattatttattgaatgaatctaaaaaaaagaacttttgcttataatagtga 18731404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 212 - 281
Target Start/End: Complemental strand, 15119846 - 15119778
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||||||  |||| |||||||| |||||||||||||||  || |||||||||||||||||||||||||||    
15119846 tatagaccacatacatcatttaatgaatgaatctaaaat-gttaatttttgcttataatagtgaccgaag 15119778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 211 - 280
Target Start/End: Complemental strand, 45472480 - 45472412
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    ||||||||| |||| |||||||||||||||||| | ||||||| ||||||| ||||||||||||| ||||    
45472480 atatagactacatacatcatttattgaatgaat-ttaaaaagtaaatttttacttataatagtgatcgaa 45472412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 210 - 278
Target Start/End: Complemental strand, 44274613 - 44274546
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||| |||| |||||||||||||||||||| |||| || || ||||| |||||||||||||||    
44274613 tatatagactacatatatcatttattgaatgaatct-aaaatgtcaacttttgtttataatagtgaccg 44274546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 207 - 278
Target Start/End: Original strand, 41824326 - 41824396
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||  |||| ||||||||||||||||| || ||||||| ||||||| |||||| |||||||||    
41824326 ttatatatagaccacatacatcatttattgaatgaacct-aaaaagtcaatttttacttatagtagtgaccg 41824396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43714129 - 43714183
Alignment:
222 ataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||||||||||||||||||| ||||||||||||||  |||||||||| ||||    
43714129 ataaatcatttattgaatgaatct-aaaaagtgaattttctcttataatagagacc 43714183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 222 - 284
Target Start/End: Complemental strand, 2544410 - 2544349
Alignment:
222 ataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagaga 284  Q
    |||| ||||||| ||||||||||||||||| | |||||||| |||||||||||| ||||||||    
2544410 ataagtcatttaatgaatgaatctaaaaaatt-aatttttgtttataatagtgatcgaagaga 2544349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 221 - 287
Target Start/End: Original strand, 14952845 - 14952910
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagagaata 287  Q
    |||| |||||||| |||||||| |||||||||| || |||||||||||| |||||||| ||||||||    
14952845 catacatcatttaatgaatgaa-ctaaaaaagtcaaattttgcttataagagtgaccgtagagaata 14952910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 231 - 281
Target Start/End: Complemental strand, 43100799 - 43100750
Alignment:
231 ttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    ||||| |||| |||||||||| |||||||||||||||||||||||||||||    
43100799 ttattcaatgtatctaaaaaa-tgaatttttgcttataatagtgaccgaag 43100750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 3123983 - 3124039
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||||||||| | |||||||||||||||| | |||||||    
3123983 catacatcatttattgaatgaatctaaaaca-tgaatttttgcttatatttgtgaccg 3124039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 233 - 278
Target Start/End: Complemental strand, 15446827 - 15446783
Alignment:
233 attgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||| ||||||| ||||||||||||||||||||||||||    
15446827 attgaatgaatttaaaaaa-tgaatttttgcttataatagtgaccg 15446783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 229 - 278
Target Start/End: Original strand, 26229533 - 26229581
Alignment:
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||| |||||||| ||||||||||||||||||||||||||    
26229533 atttaatgaatgaacctaaaaaa-tgaatttttgcttataatagtgaccg 26229581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 26836235 - 26836291
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||||||||||||||||||| | || ||||||||||||| |||| ||||    
26836235 cataaatcatttattgaatgaatctaaaata-tggatttttgcttatattagtaaccg 26836291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 209 - 278
Target Start/End: Complemental strand, 27964356 - 27964288
Alignment:
209 atatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||  |||| || |||||||||||||| ||||||| || ||||||||||||||| ||||||||    
27964356 atatatagaccacatacataatttattgaatgaacctaaaaa-gtcaatttttgcttataaaagtgaccg 27964288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 208 - 281
Target Start/End: Original strand, 44094867 - 44094939
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||||||||||| |||| | |||||||| ||||||| |||||||  ||| |||||||||||||||||| |||||    
44094867 tatatatagactacatacaacatttattaaatgaatttaaaaaa-cgaacttttgcttataatagtgatcgaag 44094939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 212 - 276
Target Start/End: Original strand, 20218617 - 20218680
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    ||||||||| ||| |||| ||||| ||||||||| ||||||||| || |||||||||||||||||    
20218617 tatagactggatacatcaattattcaatgaatct-aaaaagtgatttcttgcttataatagtgac 20218680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 11726575 - 11726629
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||| |||||||| |||||||||||||||  || ||||||||||||||||||||||    
11726575 catacatcatttaatgaatgaatctaaaat-gttaatttttgcttataatagtgac 11726629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 213 - 280
Target Start/End: Original strand, 15446850 - 15446916
Alignment:
213 atagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||||||  ||| |||||||| | |||||| |||||||| ||||||||| ||||||||||||||||||    
15446850 atagactatatacatcatttaataaatgaacctaaaaaa-tgaatttttacttataatagtgaccgaa 15446916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 27331833 - 27331895
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||| |||||| ||||||||||||| |||| ||  |||||||||||||||||||||||    
27331833 agactacatacatcattaattgaatgaatct-aaaatgttgatttttgcttataatagtgaccg 27331895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 211 - 278
Target Start/End: Complemental strand, 32316488 - 32316422
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||  |||| | |||||| |||||||| ||| |||| ||||||||||||||||||||||||||    
32316488 atatagaccacatacaacatttaatgaatgaacctagaaaa-tgaatttttgcttataatagtgaccg 32316422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 34248475 - 34248421
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| |||||||    
34248475 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatattagtgac 34248421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 220 - 278
Target Start/End: Original strand, 3098205 - 3098262
Alignment:
220 gcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||| |||||||||||||||  ||  |||||||||||||||||||||||    
3098205 gcatacatcatttaatgaatgaatctaaaat-gtagatttttgcttataatagtgaccg 3098262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 125 - 195
Target Start/End: Complemental strand, 23143631 - 23143561
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtc 195  Q
    ||||||||||||||||| |||||||||||| |  | |||||||||| ||||||| ||| || ||| |||||    
23143631 tactccctccggtcactattataagcaaaaatcaactttttaggtttattcaataaatgatgtatttggtc 23143561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 125 - 195
Target Start/End: Complemental strand, 23555421 - 23555351
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtc 195  Q
    ||||||||||||||||| |||||||||||| |  | |||||||||| ||||||| ||| || ||| |||||    
23555421 tactccctccggtcactattataagcaaaaatcaactttttaggtttattcaataaatgatgtatttggtc 23555351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 220 - 278
Target Start/End: Original strand, 25270935 - 25270992
Alignment:
220 gcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||| |||||||||||||||  ||  |||||||||||||||||||||||    
25270935 gcatacatcatttaatgaatgaatctaaaat-gtagatttttgcttataatagtgaccg 25270992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 26229592 - 26229518
Alignment:
123 tgtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||| ||||||||||||| |||||||||||| |  | |||||||||||||||| | |||  | |||||||||||    
26229592 tgtacaccctccggtcactattataagcaaaaattcattttttaggttcattcattaaatattgtatgtggtcta 26229518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 221 - 283
Target Start/End: Complemental strand, 38181820 - 38181759
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagag 283  Q
    |||| |||||||| ||||||||||||||| | || |||||||||||||||| ||||| |||||    
38181820 catacatcatttaatgaatgaatctaaaatattg-atttttgcttataataatgaccaaagag 38181759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 220 - 278
Target Start/End: Original strand, 41056967 - 41057024
Alignment:
220 gcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||| |||||||||||||||  ||  |||||||||||||||||||||||    
41056967 gcatacatcatttaatgaatgaatctaaaat-gtagatttttgcttataatagtgaccg 41057024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 277
Target Start/End: Original strand, 1961380 - 1961444
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||  |||| |||||||| ||||||||||| |||| ||  ||||||||||||||||||||||    
1961380 tatagaccacatacatcatttaatgaatgaatct-aaaatgttgatttttgcttataatagtgacc 1961444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 10222032 - 10221976
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||| ||||| | |||||||||| ||||||| |||||||    
10222032 catacatcatttattgaatgaatataaaaca-tgaatttttgtttataattgtgaccg 10221976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 277
Target Start/End: Complemental strand, 15916802 - 15916738
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||| |||| || ||||| ||||||||||||||| | || |||||||||||||||| |||||    
15916802 tatagactacatacattatttaatgaatgaatctaaaatattg-atttttgcttataatactgacc 15916738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 30429064 - 30429117
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    |||||||||||||||| |||||||||||||    | ||||||||||||||||||    
30429064 tactccctccggtcacatttataagcaaaaaacaactttttaggttcattcaat 30429117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 31024231 - 31024175
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| |||||||||||||||   ||| ||||||||||||||||||||||    
31024231 catacatcatttaatgaatgaatctaaaatgttga-tttttgcttataatagtgaccg 31024175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 196
Target Start/End: Complemental strand, 44274688 - 44274615
Alignment:
123 tgtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtct 196  Q
    |||||||||||||||||||  ||||||||||| |  | ||||||| |||||||||| ||| || ||||| ||||    
44274688 tgtactccctccggtcactgatataagcaaaaattcactttttagattcattcaataaatgatgtatgtagtct 44274615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 215 - 275
Target Start/End: Complemental strand, 3887899 - 3887840
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||| ||||||||||| |||||||| |||||||||| |  ||||||||||||| ||||||    
3887899 agactacataaatcattaattgaatgtatctaaaaaa-tagatttttgcttatattagtga 3887840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 23143571 - 23143622
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||| || |||||||  ||| ||||||||||||||||||||||    
23143571 atcatttattgaataaacctaaaaagttga-tttttgcttataatagtgaccg 23143622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 23555361 - 23555412
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||| || |||||||  ||| ||||||||||||||||||||||    
23555361 atcatttattgaataaacctaaaaagttga-tttttgcttataatagtgaccg 23555412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 215 - 275
Target Start/End: Complemental strand, 41056954 - 41056895
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||| |||| |||||||| |||||| |||||||| | ||| |||||||||||||||||||    
41056954 agactacatacatcatttaatgaatgtatctaaaacattga-tttttgcttataatagtga 41056895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 125 - 197
Target Start/End: Original strand, 44587638 - 44587710
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||||||||||||| | ||||||||||||    | |||||||||||||| ||| ||| || |||||||||||    
44587638 tactccctccggtcattattataagcaaaatactattttttaggttcattgaataaatgatgtatgtggtcta 44587710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 52; Significance: 2e-20; HSPs: 48)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 131 - 279
Target Start/End: Original strand, 11602769 - 11602904
Alignment:
131 ctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcataaatcat 230  Q
    ||||||||||| ||||||| |||||| || |||||||||||||||| | |||||| ||||||            || |||||||||||| |||| |||||    
11602769 ctccggtcactattataagtaaaagttgattttttaggttcattcattaaattatgtatgtg------------aactatatatagactacatacatcat 11602856  T
231 ttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccga 279  Q
    ||||||||||||||| |||||||||| ||||| ||||||||||||||||    
11602857 ttattgaatgaatct-aaaaagtgaacttttgtttataatagtgaccga 11602904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 122 - 278
Target Start/End: Original strand, 8169089 - 8169232
Alignment:
122 ttgtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgc 221  Q
    ||||||||| |||  ||| | |||||||||||||| |  |||||||||||||||||| ||| || |||||||||||            |||||||||| |    
8169089 ttgtactccttccaatcattattataagcaaaagttggctttttaggttcattcaataaatgatgtatgtggtcta------------tatatagactac 8169176  T
222 ataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||| |||||||||||||||||||| ||||||| || |||||||||||||||| ||||    
8169177 atacatcatttattgaatgaatct-aaaaagttaacttttgcttataatagtaaccg 8169232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 210 - 277
Target Start/End: Complemental strand, 37491344 - 37491278
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||||| |||| |||||||||| ||| |||||||||| || |||||||||||||||||||||||    
37491344 tatatagactacatacatcatttatttaataaatctaaaaa-gtaaatttttgcttataatagtgacc 37491278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 208 - 278
Target Start/End: Complemental strand, 34840687 - 34840618
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| | | |||| ||||||||||||||||||||| ||||||||| |||||||||||||| ||||||    
34840687 tatatatatattacatacatcatttattgaatgaatcta-aaaagtgaacttttgcttataataatgaccg 34840618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 212 - 278
Target Start/End: Complemental strand, 43813194 - 43813129
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| ||||  |||||||||||||||||||| |||| | ||||||||||||||||||||||||    
43813194 tatagactacatacttcatttattgaatgaatcta-aaaattaaatttttgcttataatagtgaccg 43813129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 124 - 197
Target Start/End: Complemental strand, 34840807 - 34840734
Alignment:
124 gtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||||| |||| ||||| |||||||||||||| ||  ||||||||||||||||| ||| || |||||||||||    
34840807 gtactccttccgatcactattataagcaaaagttgacattttaggttcattcaataaataatctatgtggtcta 34840734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 208 - 276
Target Start/End: Original strand, 21099310 - 21099377
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||||||| ||||  ||||||||||||||||| | |||||||||| |||| ||||||||||||||    
21099310 tatatatagactacatacgtcatttattgaatgaatat-aaaaagtgaacttttacttataatagtgac 21099377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 212 - 280
Target Start/End: Original strand, 25768690 - 25768757
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||||||| |||| |||||||  |||||||||||||||  ||| |||||||||||||||||||||||||    
25768690 tatagactacatacatcatttggtgaatgaatctaaaat-gtgtatttttgcttataatagtgaccgaa 25768757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 212 - 276
Target Start/End: Original strand, 25774253 - 25774316
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||| |||| |||||||| ||||||||||| |||| ||| |||||||||||||||||||||    
25774253 tatagactacatacatcatttagtgaatgaatct-aaaatgtgtatttttgcttataatagtgac 25774316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 250
Target Start/End: Complemental strand, 32599807 - 32599694
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcata 224  Q
    |||||||||| |||||| |||||||||||||| || || ||||||||||||| | ||| || | |||||||||            |||||||||| ||||    
32599807 tactccctcctgtcactgttataagcaaaagttgatttgttaggttcattcattaaatgatgtttgtggtcta------------tatatagactacata 32599720  T
225 aatcatttattgaatgaatctaaaaa 250  Q
     |||||||||||||||||||||||||    
32599719 catcatttattgaatgaatctaaaaa 32599694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 10095779 - 10095723
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| |||||||||||||||  || ||||||||||||||||||||||||    
10095779 catacatcatttaatgaatgaatctaaaat-gttaatttttgcttataatagtgaccg 10095723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 212 - 281
Target Start/End: Complemental strand, 23797417 - 23797349
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||||||| |||| |||||||| |||||||||||||||  |  || ||||||||||||||||||||||||    
23797417 tatagactacatacatcatttaatgaatgaatctaaaat-gcaaaattttgcttataatagtgaccgaag 23797349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 31417597 - 31417653
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||||||||| | |||||||||||||||| | |||||||    
31417597 catacatcatttattgaatgaatctaaaaca-tgaatttttgcttatatttgtgaccg 31417653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 208 - 273
Target Start/End: Original strand, 38940286 - 38940350
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagt 273  Q
    |||||||||||| |||| |||||||||| ||||||| | |||||||||||||||  ||||||||||    
38940286 tatatatagactacatacatcatttattaaatgaat-ttaaaaagtgaatttttaattataatagt 38940350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 214 - 278
Target Start/End: Original strand, 785625 - 785688
Alignment:
214 tagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||| |||||||||||||||||  |||||  |||||||||| ||||||||||||||||    
785625 tagactacatatatcatttattgaatgaacgtaaaat-gtgaatttttccttataatagtgaccg 785688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 221 - 281
Target Start/End: Complemental strand, 2943272 - 2943213
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||| |||||||| |||||||||||||||   ||| |||||||||||||||||||||||||    
2943272 catacatcatttaatgaatgaatctaaaatgttga-tttttgcttataatagtgaccgaag 2943213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 34478320 - 34478371
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| | ||||||||||||||| | ||||||||||||||||||||||||    
34478320 atcatttagtaaatgaatctaaaaaatt-aatttttgcttataatagtgaccg 34478371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 34703528 - 34703579
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||||||| |||||||| |||||||||||||||||| |||||||||    
34703528 atcattaattgaatgtatctaaaa-agtgaatttttgcttatattagtgaccg 34703579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 40416991 - 40417042
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||||||| |||||||| |||||||||||||||||| |||||||||    
40416991 atcattaattgaatgtatctaaaa-agtgaatttttgcttatattagtgaccg 40417042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 231 - 278
Target Start/End: Complemental strand, 4132437 - 4132390
Alignment:
231 ttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||| ||||||||||||||| |||||||||||||| ||||||    
4132437 ttattcaatgtatctaaaaaagtgaaattttgcttataatattgaccg 4132390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 226 - 281
Target Start/End: Original strand, 28752164 - 28752218
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||||||| ||||||||| ||||||| | ||||||||||||||||||| |||||||    
28752164 atcatttaatgaatgaatgtaaaaaatt-aatttttgcttataatagtaaccgaag 28752218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 208 - 275
Target Start/End: Original strand, 30457797 - 30457863
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||||||  |||| | |||||||||||||||| | |||||||||| |||| |||||||||||||    
30457797 tatatatagacaacatacaacatttattgaatgaat-ttaaaaagtgaacttttacttataatagtga 30457863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 31319587 - 31319649
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||| |||| ||||||| |||||||||||||||||| |  |||||| |||||||||||||    
31319587 tatagactacatacatcattttttgaatgaatctaaaaaa-tatatttttccttataatagtga 31319649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 211 - 278
Target Start/End: Original strand, 36547656 - 36547722
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||  |||| | |||||| |||||||| ||| |||| ||||||||||||||||||||||||||    
36547656 atatagaccacatacaacatttaatgaatgaacctagaaaa-tgaatttttgcttataatagtgaccg 36547722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 211 - 278
Target Start/End: Complemental strand, 43103142 - 43103076
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| ||||||| |||||||| | ||||||| |||||  || ||||||||||||||||||||||||    
43103142 atatagtctgcatacatcatttaataaatgaatttaaaat-gttaatttttgcttataatagtgaccg 43103076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 220 - 278
Target Start/End: Complemental strand, 7701249 - 7701192
Alignment:
220 gcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||| |||||||||||||||  ||  |||||||||||||||||||||||    
7701249 gcatacatcatttaatgaatgaatctaaaat-gtagatttttgcttataatagtgaccg 7701192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 212 - 278
Target Start/End: Complemental strand, 8595216 - 8595151
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| |||| |||||||| ||||||||||||||||| | ||||||| |||||| | |||||||    
8595216 tatagactacatacatcatttaatgaatgaatctaaaaaa-taaattttttcttatatttgtgaccg 8595151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 215 - 277
Target Start/End: Complemental strand, 21387642 - 21387581
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||| |||| |||||| |||||||||||||| |||| || ||||||||||||| ||||||||    
21387642 agactacatacatcattaattgaatgaatctagaaaa-tggatttttgcttatattagtgacc 21387581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 247 - 281
Target Start/End: Complemental strand, 26982799 - 26982765
Alignment:
247 aaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||||||||| ||||||||||||||||||||||||    
26982799 aaaaagtgaagttttgcttataatagtgaccgaag 26982765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 125 - 191
Target Start/End: Original strand, 34840609 - 34840675
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgt 191  Q
    ||||||||||||||| | ||||||||||||||  | ||||||| |||||||||| ||| || |||||    
34840609 tactccctccggtcattattataagcaaaagttcactttttagattcattcaataaatgatgtatgt 34840675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 208 - 278
Target Start/End: Complemental strand, 38940293 - 38940224
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||  |||  || ||||||||||||||||| |||| || ||||||||||||||||| ||||||    
38940293 tatatatagaccacattcattatttattgaatgaatct-aaaatgtcaatttttgcttataataatgaccg 38940224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 273
Target Start/End: Original strand, 6250671 - 6250732
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagt 273  Q
    |||| |||||||| |||||||||| |||||||||||| || |  |||||| |||||||||||    
6250671 tatatactgcatacatcatttattaaatgaatctaaacaaatagattttttcttataatagt 6250732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 229 - 278
Target Start/End: Complemental strand, 18654302 - 18654254
Alignment:
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||| ||| |||||||| |||| |||||||||||||||||||||    
18654302 atttattgaaagaacctaaaaaa-tgaacttttgcttataatagtgaccg 18654254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 25245223 - 25245279
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| |||||||||||||||   ||| ||||||||||||||||||||||    
25245223 catacatcatttaatgaatgaatctaaaatgttga-tttttgcttataatagtgaccg 25245279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 35274557 - 35274508
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcatt 174  Q
    |||||||||||||||| ||||||||||||| |  | ||||||||||||||    
35274557 tactccctccggtcacatttataagcaaaaatgcactttttaggttcatt 35274508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 43813124 - 43813173
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    ||||||||||||| |||||||||||| |  ||||||||| ||||||||||    
43813124 ccctccggtcactattataagcaaaaatttaatttttagattcattcaat 43813173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 211 - 247
Target Start/End: Original strand, 1548849 - 1548885
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaa 247  Q
    |||||||||||||| |||||||| |||||||||||||    
1548849 atatagactgcatatatcatttagtgaatgaatctaa 1548885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 125 - 193
Target Start/End: Original strand, 2456331 - 2456399
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtgg 193  Q
    ||||||||||| ||||| |||||||||||| |  | |||||||||||||| ||| ||| || |||||||    
2456331 tactccctccgatcactattataagcaaaaatctactttttaggttcattgaattaatgatgtatgtgg 2456399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 4406477 - 4406422
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||| |||||||| ||||||||| |||||||||||| |||| ||||||||    
4406477 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcatatattagtgacc 4406422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 5950279 - 5950330
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| |||||||||||||||  || | ||||||||||||||||||||||    
5950279 atcatttaatgaatgaatctaaaat-gttagtttttgcttataatagtgaccg 5950330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 8127912 - 8127963
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||||||||| ||| |||  ||||||| |||||||||||||||    
8127912 atcatttattgaatgaatct-aaacagttgatttttgtttataatagtgaccg 8127963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 12274869 - 12274814
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||||||||||||||  |||||  ||| ||||||||||||||||||||||    
12274869 catacatcatttattgaatgaacataaaat-gtggatttttgcttataatagtgacc 12274814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 18654545 - 18654613
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    |||||||||||||  |||||| ||||||  | ||||||||||| |||||| ||| || |||||||||||    
18654545 ccctccggtcactactataagaaaaagtttactttttaggttctttcaataaataatgtatgtggtcta 18654613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 124 - 156
Target Start/End: Original strand, 21857063 - 21857095
Alignment:
124 gtactccctccggtcacttttataagcaaaagt 156  Q
    |||||||||||||||||| ||||||||||||||    
21857063 gtactccctccggtcactattataagcaaaagt 21857095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 21886522 - 21886471
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| ||||||||||||||||| | | ||||||||||||||||| ||||||    
21886522 atcattaattgaatgaatctaaaata-taaatttttgcttataataatgaccg 21886471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 282
Target Start/End: Original strand, 27330593 - 27330648
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaaga 282  Q
    |||||||| ||||||||||||||| | | ||||||||  ||||||||||||||||||    
27330593 atcatttaatgaatgaatctaaaata-ttaatttttgtgtataatagtgaccgaaga 27330648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 31813466 - 31813415
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||||||||||||||||  || |||||||| |||||||||||||||    
31813466 atcattaattgaatgaatctaaaat-gtaaatttttgtttataatagtgaccg 31813415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 41404070 - 41404019
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| |||||||||||||||   | ||||||||||||||||||||||||    
41404070 atcatttaatgaatgaatctaaaatgat-aatttttgcttataatagtgaccg 41404019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 2e-20; HSPs: 56)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 125 - 277
Target Start/End: Complemental strand, 7313975 - 7313836
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcata 224  Q
    ||||||||||||||||| |||||||||||||| || |||||||||||| ||||| ||| || |||||||||            |||||||||||| ||||    
7313975 tactccctccggtcactattataagcaaaagttgactttttaggttcaatcaataaatgatgtatgtggtc------------tatatatagactacata 7313888  T
225 aatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
     |||||||||||||||||| | |||||||||| |||| ||||||| |||||||    
7313887 tatcatttattgaatgaat-ttaaaaagtgaacttttacttataaaagtgacc 7313836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 208 - 284
Target Start/End: Complemental strand, 27895970 - 27895895
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagaga 284  Q
    |||||||||||| |||| |||||||||| ||||||||||||||| |||| ||||| |||||||||||||||||||||    
27895970 tatatatagactacatacatcatttattaaatgaatctaaaaaa-tgaacttttgtttataatagtgaccgaagaga 27895895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 40100153 - 40100223
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||  ||| |||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||    
40100153 tatatatgaactacatacatcatttactgaatgaatctaaaaaaatgaatttttgcttataatagtgaccg 40100223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 209 - 278
Target Start/End: Original strand, 13654576 - 13654644
Alignment:
209 atatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||  ||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||    
13654576 atatatagactaaatacatcatttattgaatgaatttaaaa-agtgaatttttgcttataatagtgaccg 13654644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 3100474 - 3100412
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||| |||| |||||||||||||||||||| |||| || |||||||||||||||||||||    
3100474 tatagactacatacatcatttattgaatgaatct-aaaatgttaatttttgcttataatagtga 3100412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 1098694 - 1098763
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||| |||| || ||||||| ||||||||||||||| | || |||||||||||||||||||||    
1098694 tatatatagactacatacattatttattaaatgaatctaaaaaa-taaacttttgcttataatagtgaccg 1098763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 125 - 275
Target Start/End: Complemental strand, 1098772 - 1098635
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcata 224  Q
    ||||||||||||||||| ||||||||||||||  | ||||||| |||||| ||| ||| || ||||| |||||            |||||||||  ||||    
1098772 tactccctccggtcactattataagcaaaagtttattttttagattcatttaataaataatgtatgtagtcta------------tatatagaccacata 1098685  T
225 aatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
     ||||||||||||||||||||| |||||| || |||| |||||||||||||    
1098684 catcatttattgaatgaatcta-aaaagtcaacttttacttataatagtga 1098635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 43506174 - 43506229
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||||| |||||||||||||||| ||||| ||||||||||||||||||||    
43506174 catacatcatttaatgaatgaatctaaaaa-gtgaaattttgcttataatagtgacc 43506229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 7313897 - 7313966
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||  |||| |||||||||||| |||| ||||||| || || |||||||||||||||||||||    
7313897 tatatatagaccacatacatcatttattgattgaacctaaaaa-gtcaacttttgcttataatagtgaccg 7313966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 11262388 - 11262331
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccga 279  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| ||||||||||    
11262388 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatattagtgaccga 11262331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 25713765 - 25713834
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||  |||| |||||||||||||||||||||||||| | || ||||| |||||||| ||||||    
25713765 tatatatagaccacatatatcatttattgaatgaatctaaaaaa-tcaacttttgtttataataatgaccg 25713834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 8717852 - 8717799
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    ||||||||||| ||||| |||||||||||| |  ||||||||||||||||||||    
8717852 tactccctccgatcactattataagcaaaaatcaaatttttaggttcattcaat 8717799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 125 - 206
Target Start/End: Original strand, 18261595 - 18261676
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaa 206  Q
    ||||||||||||||||| ||||||||||||||  | ||| ||| |||||||||| ||| || ||||||  |||||| |||||    
18261595 tactccctccggtcactattataagcaaaagttcactttatagattcattcaataaataatgtatgtgaactaaaatgtgaa 18261676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 229 - 278
Target Start/End: Complemental strand, 18261652 - 18261604
Alignment:
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||||||| ||| ||||| |||||||||||||||||||||    
18261652 atttattgaatgaatctataaa-gtgaacttttgcttataatagtgaccg 18261604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 25408603 - 25408547
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||||||||| | |||||||||||||||| | |||||||    
25408603 catacatcatttattgaatgaatctaaaata-tgaatttttgcttatatttgtgaccg 25408547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 25792926 - 25792982
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| |||||||| ||||||| || ||||||||||||||||||||||||    
25792926 catacatcatttaatgaatgaacctaaaaa-gtaaatttttgcttataatagtgaccg 25792982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 212 - 277
Target Start/End: Original strand, 32911563 - 32911628
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||||||  ||| |||||||| |||||||| |||||||  ||| |||||||||||||||||||||    
32911563 tatagactaaatacatcatttaatgaatgaacctaaaaagttgattttttgcttataatagtgacc 32911628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 37944662 - 37944606
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| |||||||||    
37944662 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatattagtgaccg 37944606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 42013882 - 42013826
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| |||||||||    
42013882 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatattagtgaccg 42013826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 13391676 - 13391616
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattat 185  Q
    |||||||||| |||||| |||||||||||| |  | |||||||||||||||||| ||||||    
13391676 tactccctcctgtcactgttataagcaaaaatcaactttttaggttcattcaataaattat 13391616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 208 - 288
Target Start/End: Complemental strand, 13654582 - 13654503
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagagaataa 288  Q
    ||||||| |||  |||| ||||||||||||||||| || ||||||| ||| ||| |||||||||||||||| || ||||||    
13654582 tatatatggaccacatacatcatttattgaatgaacct-aaaaagtcaatatttacttataatagtgaccggagggaataa 13654503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 25358113 - 25358062
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||||||||| ||||| | ||||||| ||||||||||||||||    
25358113 atcatttattgaatgaatcttaaaaa-taaatttttacttataatagtgaccg 25358062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 127 - 195
Target Start/End: Complemental strand, 25792989 - 25792921
Alignment:
127 ctccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtc 195  Q
    ||||||||||||||| |||||||||||| |  | |||||||||||||||| | ||| || |||||||||    
25792989 ctccctccggtcactattataagcaaaaatttactttttaggttcattcattaaatgatgtatgtggtc 25792921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 213 - 281
Target Start/End: Original strand, 36895308 - 36895375
Alignment:
213 atagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    ||||||| |||| |||||||||||||||||||||||| | || |||||   ||||||||||||||||||    
36895308 atagactacatacatcatttattgaatgaatctaaaata-tgtattttaatttataatagtgaccgaag 36895375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 43506167 - 43506112
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||||| ||| |||||||||||| ||||| ||||||||||||||||||||    
43506167 catacatcatttaatgattgaatctaaaaa-gtgaaattttgcttataatagtgacc 43506112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 231 - 278
Target Start/End: Complemental strand, 892601 - 892555
Alignment:
231 ttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||||||||| |||||||||||||||||||||| ||||    
892601 ttattcaatgaatctaaaaa-gtgaatttttgcttataatagtaaccg 892555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 6763771 - 6763833
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| ||| |||||| |||||||||||||| |||| || ||||||||||||| |||||||||    
6763771 agactgaatacatcattaattgaatgaatctagaaaa-tggatttttgcttatattagtgaccg 6763833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 128 - 195
Target Start/End: Original strand, 13654507 - 13654574
Alignment:
128 tccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtc 195  Q
    |||||||||||||| ||||||| |||  | || |||||||||||||||||| ||| || |||||||||    
13654507 tccctccggtcactattataagtaaatattgactttttaggttcattcaataaatgatgtatgtggtc 13654574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 17225159 - 17225210
Alignment:
127 ctccctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    ||||||||||||  | |||||||||||||| || ||||||||||||||||||    
17225159 ctccctccggtcgttattataagcaaaagttgactttttaggttcattcaat 17225210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 280
Target Start/End: Original strand, 37944682 - 37944740
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||| |||||| |||||||| |||||||||| | |||||||||||||| |||||||||||    
37944682 catacatcattaattgaatgtatctaaaaaa-taaatttttgcttatattagtgaccgaa 37944740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 40515281 - 40515231
Alignment:
227 tcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||||||||| |||||| || |||| ||||||||||||||||    
40515281 tcatttattgaatgaatcta-aaaagtcaacttttacttataatagtgaccg 40515231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 211 - 273
Target Start/End: Original strand, 238796 - 238857
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagt 273  Q
    ||||||| | |||| |||||||||| ||||||| ||||||| ||||||||||| |||||||||    
238796 atatagattacatacatcatttattcaatgaatataaaaaa-tgaatttttgcctataatagt 238857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 19531381 - 19531434
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||| |||||| |||||||| |||||||| |||||||||||||||||| ||||||    
19531381 catacatcattaattgaatgtatctaaaa-agtgaatttttgcttatattagtga 19531434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 219 - 277
Target Start/End: Original strand, 36759438 - 36759495
Alignment:
219 tgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||| |||||||||||||||||  ||||| ||||||||||| ||||||||| |||||    
36759438 tgcatacatcatttattgaatgaacgtaaaa-agtgaatttttccttataataatgacc 36759495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 36864502 - 36864555
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||| |||||||||||||||||||| |||||||||| ||||  ||||||||||||    
36864502 catatatcatttattgaatgaatct-aaaaagtgaacttttatttataatagtga 36864555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 209 - 275
Target Start/End: Complemental strand, 40100159 - 40100094
Alignment:
209 atatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||||||||  || | |||||||||| ||||||| |||||| || |||||||||||||||||||||    
40100159 atatatagaccacacacatcatttattaaatgaatttaaaaa-gtcaatttttgcttataatagtga 40100094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 281
Target Start/End: Complemental strand, 2673916 - 2673848
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||||||  |||| ||||||||||||||| | ||||||| || ||  |||||||||||||||||||||||    
2673916 tatagaccacatacatcatttattgaatgtacctaaaaa-gtcaaaatttgcttataatagtgaccgaag 2673848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 3851443 - 3851499
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| ||| |||| |||||||||| |||||||||||||||| |||||||||    
3851443 catacatcattaattaaatgtatctaaaaaa-tgaatttttgcttatattagtgaccg 3851499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 227 - 276
Target Start/End: Complemental strand, 9707139 - 9707091
Alignment:
227 tcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||||||||||| ||| ||| || ||||||||||||||||||||||    
9707139 tcatttattgaatgaacctagaaa-gtaaatttttgcttataatagtgac 9707091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 11262408 - 11262464
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||| |||| |||||||||||||||| |||||||||    
11262408 catacatcattaattgaatgtatctacaaaa-tgaatttttgcttatattagtgaccg 11262464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 13356217 - 13356273
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||||||||||||||| || |||||||  |||||||||||||||| ||||||    
13356217 catacatcatttattgaatgaa-cttaaaaagtagatttttgcttataataatgaccg 13356273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 19531361 - 19531305
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| | |||||||    
19531361 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatatttgtgaccg 19531305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 211 - 284
Target Start/End: Original strand, 22227051 - 22227123
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagaga 284  Q
    |||||||||  ||| |||||||| |||||||| ||||||   ||| |||||||||||||||||||||| |||||    
22227051 atatagactaaatatatcatttaatgaatgaacctaaaacgttga-tttttgcttataatagtgaccggagaga 22227123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 23914901 - 23914845
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||    
23914901 catacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgaccg 23914845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 197
Target Start/End: Complemental strand, 25713836 - 25713771
Alignment:
132 tccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    |||||||| | |||||| ||||||| || ||||||| |||||||||| ||| || |||||||||||    
25713836 tccggtcattattataaacaaaagttgattttttagattcattcaataaatgatatatgtggtcta 25713771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 26300171 - 26300115
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| || |||||||||||||| |||||||||    
26300171 catacatcattaattgaatgtatctaaaaa-gtaaatttttgcttatattagtgaccg 26300115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 277
Target Start/End: Original strand, 33075136 - 33075200
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||  |||| |||||||| |||||||| |||||| | | |||||||||||||||||||||||    
33075136 tatagaccacatacatcatttaatgaatgaacctaaaatatt-aatttttgcttataatagtgacc 33075200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 40515277 - 40515317
Alignment:
237 aatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||| ||||| |||||||||||||||||||||    
40515277 aatgaatctaaaaa-gtgaacttttgcttataatagtgaccg 40515317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 42013902 - 42013958
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| |||||||| |||||||||||||||||| | |||||||    
42013902 catacatcattaattgaatgtatctaaaa-agtgaatttttgcttatatttgtgaccg 42013958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 71314 - 71263
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| ||||||||||||||||| |  || ||||||||||||||||||||||    
71314 atcattaattgaatgaatctaaaatataga-tttttgcttataatagtgaccg 71263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 125 - 197
Target Start/End: Original strand, 2673842 - 2673914
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    |||| ||| |||||||| |||||||||||  | || ||||||||| |||||||| ||| || |||||||||||    
2673842 tacttccttcggtcactattataagcaaattttgactttttaggtacattcaataaatgatgtatgtggtcta 2673914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 274
Target Start/End: Original strand, 4082823 - 4082870
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtg 274  Q
    |||||||||||||| ||||| |||| ||||||||||| |||||||||||    
4082823 atcatttattgaataaatct-aaaatgtgaatttttgtttataatagtg 4082870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 130 - 178
Target Start/End: Original strand, 13356106 - 13356154
Alignment:
130 cctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    |||||||||||| |||||||||||| |  | ||||||||||||||||||    
13356106 cctccggtcactattataagcaaaattttactttttaggttcattcaat 13356154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 17967395 - 17967450
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||||||||||||||| ||||| | | |||||||| ||||||||||||||    
17967395 catacatcatttattgaatgaatataaaata-tcaatttttgtttataatagtgacc 17967450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 25776989 - 25777040
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||||||| || |||| ||  |||||||||||||||||||||||    
25776989 atcatttattgaatgaa-cttaaaaggtatatttttgcttataatagtgaccg 25777040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 130 - 178
Target Start/End: Original strand, 40515227 - 40515275
Alignment:
130 cctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    |||||||||||| ||||||| |||||| || ||||||| ||||||||||    
40515227 cctccggtcactattataagtaaaagttgactttttagattcattcaat 40515275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 2e-20; HSPs: 79)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 125 - 281
Target Start/End: Original strand, 11796580 - 11796723
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcata 224  Q
    |||||||  |||||||| |||||||||||||| || ||||| | |||||||||||||| || ||||||||            ||||||||||| | ||||    
11796580 tactcccatcggtcactattataagcaaaagttgactttttcgattcattcaatgaatgatatatgtggt------------ttatatatagattacata 11796667  T
225 aatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
     |||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||    
11796668 catcatttattgaataaatctaaaa-agtgaatttttgcttataatagtggccgaag 11796723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 22020176 - 22020121
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||    
22020176 catatatcatttattgaatgaatctaaaaa-gtgaacttttgcttataatagtgacc 22020121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 208 - 275
Target Start/End: Complemental strand, 5535787 - 5535721
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||| ||| |||| |||||||||||||||||||||||||| ||| |||||||||||| ||||||    
5535787 tatatataaactacatacatcatttattgaatgaatctaaaaaa-tgagtttttgcttatactagtga 5535721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 210 - 277
Target Start/End: Complemental strand, 15660006 - 15659940
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||||| |||| ||||||||||||||||| || |||||||||| |||||||| |||||||||||    
15660006 tatatagactacatacatcatttattgaatgaacct-aaaaagtgaacttttgcttgtaatagtgacc 15659940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 125 - 277
Target Start/End: Original strand, 37255677 - 37255816
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcata 224  Q
    |||||||| | |||||| |||||||||||||| |  ||||||| |||||||||| ||| || |||||||||||            |||||| ||| ||||    
37255677 tactcccttctgtcactattataagcaaaagttggttttttagattcattcaataaatgatgtatgtggtcta------------tatataaactacata 37255764  T
225 aatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
     || ||||||||||||||| |||||| ||||| ||||||||||||||||||||    
37255765 cataatttattgaatgaatttaaaaa-gtgaacttttgcttataatagtgacc 37255816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 207 - 281
Target Start/End: Complemental strand, 37255756 - 37255683
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    ||||||||||||  |||| ||||||||||||||||||||||||||   || ||||||||||||||||||| ||||    
37255756 ttatatatagaccacatacatcatttattgaatgaatctaaaaaa-ccaacttttgcttataatagtgacagaag 37255683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 3094411 - 3094358
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    ||||||||||||||||| |||||| ||||||| || ||||||||||||||||||    
3094411 tactccctccggtcactattataaccaaaagttgactttttaggttcattcaat 3094358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 19934698 - 19934642
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||||||||||||||||||| ||||||| | |||||||||||||||||||||    
19934698 catacatcatttattgaatgaatcta-aaaagtggaattttgcttataatagtgaccg 19934642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 29006895 - 29006839
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||||||||||| |  |||||||||||||||||||||||    
29006895 catacatcatttattgaatgaatctaaaaaa-tagatttttgcttataatagtgaccg 29006839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 54164873 - 54164817
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||||||||||||||||||| ||||||| | |||||||||||||||||||||    
54164873 catacatcatttattgaatgaatcta-aaaagtggaattttgcttataatagtgaccg 54164817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 54164893 - 54164949
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||||||||||| |  |||||||||||||||||||||||    
54164893 catacatcatttattgaatgaatctaaaaaa-tagatttttgcttataatagtgaccg 54164949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 129 - 196
Target Start/End: Original strand, 20215566 - 20215633
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtct 196  Q
    ||||||||||||| |||||||||||| | ||  ||||||||||||||||| ||| || ||||||||||    
20215566 ccctccggtcactattataagcaaaaattgacattttaggttcattcaataaatgatgtatgtggtct 20215633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 217 - 275
Target Start/End: Complemental strand, 3504141 - 3504084
Alignment:
217 actgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||| |||||| ||||||||||||||||||| |||||||||| ||||| ||||||    
3504141 actgcatacatcattaattgaatgaatctaaaaaa-tgaatttttgtttatattagtga 3504084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 3740375 - 3740444
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||| |||  ||||||||||||||||| || ||||||| || ||||||||||| |||||||||    
3740375 tatatatagactacatgcatcatttattgaatgaacct-aaaaagtcaacttttgcttatattagtgaccg 3740444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 233 - 283
Target Start/End: Original strand, 13689628 - 13689677
Alignment:
233 attgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagag 283  Q
    ||||||||||||||||| |||||||||||||||||| ||||||||| ||||    
13689628 attgaatgaatctaaaa-agtgaatttttgcttatattagtgaccggagag 13689677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 16912512 - 16912470
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaa 250  Q
    |||||||||||| |||| |||||||||||||||||||||||||    
16912512 tatatatagactacatacatcatttattgaatgaatctaaaaa 16912470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 19934718 - 19934771
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||| |||||||||||||||||||||||||| |  ||||||||||||||||||||    
19934718 catacatcatttattgaatgaatctaaaaaa-tagatttttgcttataatagtga 19934771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 26636520 - 26636573
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||| |||||||||||||||||||||||||| | ||||||| |||||||||||||    
26636520 catacatcatttattgaatgaatctaaaaaa-taaatttttacttataatagtga 26636573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 208 - 278
Target Start/End: Complemental strand, 26909737 - 26909668
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||| |||||| || ||||||| ||||||||||||||| | ||||||| ||||||||| ||||||    
26909737 tatatatagattgcatacattatttattaaatgaatctaaaaaa-ttaatttttacttataataatgaccg 26909668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 226 - 284
Target Start/End: Original strand, 46518505 - 46518562
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagaga 284  Q
    |||||||||||||| || ||||||| || ||||||||||||||||| ||||||||||||    
46518505 atcatttattgaataaacctaaaaa-gttaatttttgcttataataatgaccgaagaga 46518562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 221 - 283
Target Start/End: Complemental strand, 54106535 - 54106474
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagag 283  Q
    |||| |||||||||||||||||||||||| | |||||||||||||||| | ||||||| ||||    
54106535 catacatcatttattgaatgaatctaaaata-tgaatttttgcttatatttgtgaccggagag 54106474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 208 - 273
Target Start/End: Original strand, 2254020 - 2254084
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagt 273  Q
    |||||||||||| |||| |||||||||||||||||| ||||||| | || ||||| ||||||||||    
2254020 tatatatagactacatatatcatttattgaatgaatttaaaaaa-taaacttttgtttataatagt 2254084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 20215627 - 20215571
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||||||||||||||| ||||||  || ||||||||||||||||||||||||    
20215627 catacatcatttattgaatgaacctaaaat-gtcaatttttgcttataatagtgaccg 20215571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 220 - 281
Target Start/End: Original strand, 28815862 - 28815922
Alignment:
220 gcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    ||||| |||||||||| |||||| ||||||| || || ||||||||||||||||||||||||    
28815862 gcatatatcatttattaaatgaacctaaaaa-gtcaacttttgcttataatagtgaccgaag 28815922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 29006915 - 29006971
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||| |||||| ||| | |||||||||||||||||||||    
29006915 catacatcatttattgaatgaatttaaaaa-gtggaattttgcttataatagtgaccg 29006971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 224 - 281
Target Start/End: Original strand, 41905870 - 41905926
Alignment:
224 aaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    ||||||||||||||||||| |||||| | |||||||||||||||| | ||||||||||    
41905870 aaatcatttattgaatgaacctaaaaca-tgaatttttgcttatatttgtgaccgaag 41905926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 212 - 277
Target Start/End: Original strand, 52914069 - 52914133
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||  |||| |||||||| ||||||||||||||| | | |||||||||||||||||||||||    
52914069 tatagaccacatacatcatttaatgaatgaatctaaaatatt-aatttttgcttataatagtgacc 52914133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 55936067 - 55936123
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| ||||||||||||||| | ||| ||||||||||||||||||||||    
55936067 catacatcatttaatgaatgaatctaaaatattga-tttttgcttataatagtgaccg 55936123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 130 - 178
Target Start/End: Complemental strand, 3740448 - 3740400
Alignment:
130 cctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    ||||||||||||  ||||||||||||| || ||||||||||||||||||    
3740448 cctccggtcactaatataagcaaaagttgactttttaggttcattcaat 3740400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 207 - 275
Target Start/End: Original strand, 5535779 - 5535846
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||||||||||  |||| |||| |||||||||||| |||| || || |||||||||||||||||||||    
5535779 ttatatatagaccacatacatcagttattgaatgaacctaacaa-gtcaatttttgcttataatagtga 5535846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 17657977 - 17658017
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaa 251  Q
    ||||||||| |||| ||||||||||||||||||||||||||    
17657977 atatagactacatatatcatttattgaatgaatctaaaaaa 17658017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 19934637 - 19934705
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||||||||||| |||||||||||| |  | ||||||| |||||||||| ||| || |||||||||||    
19934637 ccctccggtcactattataagcaaaattccactttttagattcattcaataaatgatgtatgtggtcta 19934705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 24941171 - 24941116
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| ||||||||    
24941171 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatattagtgacc 24941116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 215 - 283
Target Start/End: Original strand, 31262668 - 31262735
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagag 283  Q
    ||||| |||| ||||||||| |||||||||| |||| || || |||||||||||||||||||| |||||    
31262668 agactacatatatcatttatcgaatgaatct-aaaatgtcaaattttgcttataatagtgaccaaagag 31262735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 54164812 - 54164880
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||||||||||| |||||||||||| |  | ||||||| |||||||||| ||| || |||||||||||    
54164812 ccctccggtcactattataagcaaaattccactttttagattcattcaataaatgatgtatgtggtcta 54164880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 229 - 276
Target Start/End: Original strand, 9993532 - 9993578
Alignment:
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    ||||||||||| ||||||||| |||||||||||| |||||||||||||    
9993532 atttattgaataaatctaaaa-agtgaatttttgtttataatagtgac 9993578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 208 - 279
Target Start/End: Complemental strand, 11796658 - 11796588
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccga 279  Q
    |||||||| ||  |||| |||||| |||||||||||| ||||| || || ||||||||||||||||||||||    
11796658 tatatataaaccacatatatcattcattgaatgaatcgaaaaa-gtcaacttttgcttataatagtgaccga 11796588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 126 - 197
Target Start/End: Original strand, 15659931 - 15660002
Alignment:
126 actccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    |||||||| ||||||| ||| ||||||||||  | |||||||||||||||||| ||| || ||||| |||||    
15659931 actccctctggtcactattacaagcaaaagttcactttttaggttcattcaataaatgatgtatgtagtcta 15660002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 211 - 278
Target Start/End: Original strand, 20788105 - 20788171
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||  |||| | |||||| |||||||| ||| |||| ||||||||||||||||||||||||||    
20788105 atatagaccacatacaacatttaatgaatgaacctagaaaa-tgaatttttgcttataatagtgaccg 20788171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 228 - 283
Target Start/End: Complemental strand, 31280386 - 31280332
Alignment:
228 catttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagag 283  Q
    |||||||||||||||||||||||| ||   ||||||||||||||||||||| ||||    
31280386 catttattgaatgaatctaaaaaa-tggtgttttgcttataatagtgaccggagag 31280332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 229 - 276
Target Start/End: Original strand, 35005143 - 35005189
Alignment:
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    ||||||||||||||||| ||||| ||||||||||||||||| ||||||    
35005143 atttattgaatgaatct-aaaaattgaatttttgcttataacagtgac 35005189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 226 - 276
Target Start/End: Complemental strand, 3094322 - 3094273
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||||||||||||| ||||||| | |||||||| |||||||||||||    
3094322 atcatttattgaatgaatataaaaaa-taaatttttgtttataatagtgac 3094273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 212 - 278
Target Start/End: Original strand, 3094337 - 3094402
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| ||||  |||||||||||||||| || ||||||| || ||||| |||||||||||||||    
3094337 tatagactacatacgtcatttattgaatgaacct-aaaaagtcaacttttggttataatagtgaccg 3094402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 4386389 - 4386431
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaa 250  Q
    |||||||| ||| |||| |||||||||||||||||||||||||    
4386389 tatatataaactacatagatcatttattgaatgaatctaaaaa 4386431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 210 - 276
Target Start/End: Original strand, 6087502 - 6087567
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||||| |||| |||||||||||||| |||||  |||| | |||||||||||||||| |||||    
6087502 tatatagactacatacatcatttattgaataaatct-gaaaattaaatttttgcttataattgtgac 6087567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 228 - 278
Target Start/End: Complemental strand, 20788089 - 20788040
Alignment:
228 catttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||||||| |||||| | ||||||||||||||||||||||||||    
20788089 catttaatgaatgaacctaaaata-tgaatttttgcttataatagtgaccg 20788040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 212 - 250
Target Start/End: Original strand, 21586989 - 21587027
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaa 250  Q
    |||||||| |||| |||||||||||||||||||||||||    
21586989 tatagactacatacatcatttattgaatgaatctaaaaa 21587027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 125 - 191
Target Start/End: Original strand, 22020111 - 22020177
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgt 191  Q
    ||||||||| ||||||| ||||||||||||||  | ||||||| |||||||||| ||| || |||||    
22020111 tactccctctggtcactattataagcaaaagttcactttttagattcattcaataaatgatatatgt 22020177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 212 - 278
Target Start/End: Original strand, 22720577 - 22720642
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||| || | ||||| |||| ||||||||| ||| | |||||||||||||||||||||    
22720577 tatagactgcatacattaattattcaatgtatctaaaaa-gtggagttttgcttataatagtgaccg 22720642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 211 - 277
Target Start/End: Complemental strand, 24851481 - 24851416
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||||||  |||| | |||||| |||||||| ||| |||| |||||||||||||||||||||||||    
24851481 atatagacaacatacaacatttaatgaatgaacctagaaaa-tgaatttttgcttataatagtgacc 24851416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 129 - 195
Target Start/End: Complemental strand, 54164954 - 54164888
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtc 195  Q
    ||||||||||||| |||||||||||| |  | ||||||| |||||||||| ||| || |||||||||    
54164954 ccctccggtcactattataagcaaaaatctattttttagattcattcaataaatgatgtatgtggtc 54164888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 207 - 276
Target Start/End: Complemental strand, 4386397 - 4386329
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    ||||||||||||  |||| |||||||| | ||| |||||||||| || || |||||||||||||||||||    
4386397 ttatatatagaccacatacatcatttaataaattaatctaaaaa-gtcaacttttgcttataatagtgac 4386329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 5281215 - 5281271
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| |||||||| ||||||||||| |||||| |||||||||    
5281215 catacatcattaattgaatgtatctaaaa-agtgaatttttacttatattagtgaccg 5281271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 6462792 - 6462844
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtg 274  Q
    |||| |||||||||||||||||||||||||| | || ||||| |||||||||||    
6462792 catacatcatttattgaatgaatctaaaaaa-taaaattttgtttataatagtg 6462844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 228 - 277
Target Start/End: Complemental strand, 12927162 - 12927114
Alignment:
228 catttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||| |||||||| ||| |||| |||||||||||||||||||||||||    
12927162 catttaatgaatgaacctagaaaa-tgaatttttgcttataatagtgacc 12927114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 124 - 197
Target Start/End: Original strand, 16912433 - 16912506
Alignment:
124 gtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    |||||||||||| ||| | ||||||| ||||||  ||||||||| |||||||||| ||| || ||||| |||||    
16912433 gtactccctccgatcaatattataagtaaaagtgtaatttttagattcattcaataaatgatgtatgtagtcta 16912506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 226 - 271
Target Start/End: Original strand, 19595523 - 19595567
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataata 271  Q
    |||||||||||||||||||| |||| ||||| ||||||||||||||    
19595523 atcatttattgaatgaatct-aaaatgtgaaattttgcttataata 19595567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 166
Target Start/End: Complemental strand, 29588525 - 29588484
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaattttta 166  Q
    ||||||||||||||||| ||||||||||||||  ||||||||    
29588525 tactccctccggtcactattataagcaaaagttcaattttta 29588484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 38382036 - 38381980
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| | |||||||||||||  || ||||||||||||||||||||||||    
38382036 catacatcatttaatcaatgaatctaaaat-gtaaatttttgcttataatagtgaccg 38381980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 250
Target Start/End: Original strand, 41459494 - 41459523
Alignment:
221 cataaatcatttattgaatgaatctaaaaa 250  Q
    ||||||||||||||||||||||||||||||    
41459494 cataaatcatttattgaatgaatctaaaaa 41459523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 247 - 280
Target Start/End: Original strand, 52673703 - 52673736
Alignment:
247 aaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||||||||| |||||||||||||||||||||||    
52673703 aaaaagtgaaattttgcttataatagtgaccgaa 52673736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 52817647 - 52817703
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||    
52817647 catacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgaccg 52817703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 54106555 - 54106611
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||||||||| | | |||||||||||||| | |||||||    
54106555 catacatcatttattgaatgaatctaaaaca-taaatttttgcttatatttgtgaccg 54106611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 231 - 276
Target Start/End: Original strand, 54338916 - 54338960
Alignment:
231 ttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    ||||||||||||||||||||| | ||||||||||||||||| ||||    
54338916 ttattgaatgaatctaaaaaa-taaatttttgcttataataatgac 54338960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 125 - 197
Target Start/End: Original strand, 4386318 - 4386390
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    |||||||||| |||||| |||||||||||||| || ||||||| || ||| | | ||| || |||||||||||    
4386318 tactccctccagtcactattataagcaaaagttgactttttagattaatttattaaatgatgtatgtggtcta 4386390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 281
Target Start/End: Complemental strand, 5418575 - 5418516
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||| |||||| |||||||| |||||||||| ||| |||||||| ||| ||||||||||||    
5418575 catacatcattaattgaatgtatctaaaaaattga-tttttgctcatattagtgaccgaag 5418516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 18626767 - 18626716
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||| |||||||| |||||||||||||||   | |||||||||||||||||||||    
18626767 catacatcatttaatgaatgaatctaaaa---ttaatttttgcttataatagtga 18626716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 20598312 - 20598261
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||||| |||||||| | |||||||||||||||| | |||||||    
20598312 atcatttattgaatgtatctaaaaca-tgaatttttgcttatatttgtgaccg 20598261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 22235345 - 22235396
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||| |||||||||||||  |||| ||||||||||||||||||||||    
22235345 atcagttattcaatgaatctaaaat-gtgattttttgcttataatagtgaccg 22235396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 23568465 - 23568516
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| |||||||||||||||  || | ||||||||||||||||||||||    
23568465 atcatttaatgaatgaatctaaaat-gttagtttttgcttataatagtgaccg 23568516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 25700527 - 25700567
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaa 251  Q
    ||||||||  |||| ||||||||||||||||||||||||||    
25700527 atatagaccacatacatcatttattgaatgaatctaaaaaa 25700567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 174
Target Start/End: Complemental strand, 28815919 - 28815879
Alignment:
134 cggtcacttttataagcaaaagtagaatttttaggttcatt 174  Q
    |||||||| |||||||||||||| || ||||||||||||||    
28815919 cggtcactattataagcaaaagttgactttttaggttcatt 28815879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 129 - 197
Target Start/End: Complemental strand, 33694110 - 33694042
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    |||||| |||||| ||||||||||||  |  | ||||||||||||||| | |||||| |||||||||||    
33694110 ccctccagtcactattataagcaaaaaaaataattttaggttcattcattaaattatgtatgtggtcta 33694042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 136 - 196
Target Start/End: Complemental strand, 35005189 - 35005129
Alignment:
136 gtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtct 196  Q
    |||||| |||||||||||| |  ||||||||| |||||||||| ||| || ||||||||||    
35005189 gtcactgttataagcaaaaattcaatttttagattcattcaataaataatgtatgtggtct 35005129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 212 - 280
Target Start/End: Complemental strand, 36870042 - 36869974
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||||||| ||||  ||||||||||||||||||||||||    | |||| ||||||| |||||||||||    
36870042 tatagacttcatacgtcatttattgaatgaatctaaaaattaaacttttagcttatattagtgaccgaa 36869974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 281
Target Start/End: Original strand, 40814749 - 40814808
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||| |||||||| ||||||||||| |||| || |||||||| |||||| |||||||||||    
40814749 catatatcatttaatgaatgaatct-aaaatgttaatttttgtttataacagtgaccgaag 40814808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 44171508 - 44171464
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaa 251  Q
    ||||||||||| | |||| |||||||||||||||||| |||||||    
44171508 ttatatatagattacatacatcatttattgaatgaatttaaaaaa 44171464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 249
Target Start/End: Original strand, 52674897 - 52674925
Alignment:
221 cataaatcatttattgaatgaatctaaaa 249  Q
    |||||||||||||||||||||||||||||    
52674897 cataaatcatttattgaatgaatctaaaa 52674925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 54713153 - 54713102
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| | |||||||||||||||  || ||||||||||||||||||||||||    
54713153 atcattaaatgaatgaatctaaaat-gtaaatttttgcttataatagtgaccg 54713102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 2e-19; HSPs: 33)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 123 - 269
Target Start/End: Original strand, 24418874 - 24419007
Alignment:
123 tgtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgca 222  Q
    ||||||||||||||||||| ||||| || ||||| || |||||| ||||||||||| ||| || |||||||||||            |||||||||  ||    
24418874 tgtactccctccggtcactattataggctaaagttgactttttaagttcattcaataaatgatgtatgtggtcta------------tatatagacgaca 24418961  T
223 taaatcatttattgaatgaatctaaaaaagtgaatttttgcttataa 269  Q
    || |||||||||||||||||||| |||||||||||||||||||||||    
24418962 tacatcatttattgaatgaatct-aaaaagtgaatttttgcttataa 24419007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 227 - 277
Target Start/End: Original strand, 6260694 - 6260744
Alignment:
227 tcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||    
6260694 tcatttattgaatgaatctaaaaaaatgaatttttgcttataatagtgacc 6260744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 207 - 280
Target Start/End: Complemental strand, 13841922 - 13841850
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||||| ||||||  ||| |||||||||||||||||| |||||| || ||||||||||||||||||||||||||    
13841922 ttatatgtagactaaatacatcatttattgaatgaatttaaaaa-gtaaatttttgcttataatagtgaccgaa 13841850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 24820377 - 24820433
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||    
24820377 catacatcatttattgaatgaatctaaaaa-gagaatttttgcttataatagtgaccg 24820433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 36308059 - 36308100
Alignment:
209 atatatagactgcataaatcatttattgaatgaatctaaaaa 250  Q
    |||||||||||||||| |||||||||||||||||||||||||    
36308059 atatatagactgcatacatcatttattgaatgaatctaaaaa 36308100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 24820358 - 24820303
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| ||||||||||||||||| |||| || ||||||||||||||||||||||||||    
24820358 catacatcatttattgaatgaacctaagaa-gtgaatttttgcttataatagtgacc 24820303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 7377634 - 7377688
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||| |||||| |||||||| |||||||||| |||||||||||||||| ||||||    
7377634 catacatcattaattgaatgtatctaaaaaaatgaatttttgcttatattagtga 7377688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 212 - 277
Target Start/End: Complemental strand, 5888405 - 5888341
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||  |||| |||||||| |||||||||||||||  || |||||||||||||||||||||||    
5888405 tatagacaacatacatcatttaatgaatgaatctaaaac-gttaatttttgcttataatagtgacc 5888341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 211 - 276
Target Start/End: Original strand, 17871833 - 17871897
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||||  ||| |||||||| |||||||| |||||||| ||| ||||||||||||||||||||    
17871833 atatagactaaatacatcatttaatgaatgaacctaaaaaattga-tttttgcttataatagtgac 17871897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 29424063 - 29424119
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||||||||||||||||| | |||||||||||||||| | |||||||    
29424063 catacatcatttattgaatgaatctaaaata-tgaatttttgcttatatttgtgaccg 29424119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 7428952 - 7428901
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagt 273  Q
    |||| ||||||||||||||||| |||||| | |||||||||||||||||||||    
7428952 catacatcatttattgaatgaacctaaaata-tgaatttttgcttataatagt 7428901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 10117055 - 10117106
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||||||||||||||||  || ||||||||||||||||||||||||    
10117055 atcattaattgaatgaatctaaaat-gtaaatttttgcttataatagtgaccg 10117106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 15037835 - 15037887
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||||||| |||||||| | || |||| ||||||||||||||||    
15037835 atcatttattgaatgaacctaaaaaaataaaattttacttataatagtgaccg 15037887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 26014629 - 26014574
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| ||||||||    
26014629 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatattagtgacc 26014574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 36698715 - 36698766
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||||||||| || ||| ||||||| ||||||||||||||||||    
36698715 atcatttattgaatgaatccaacaaa-tgaatttatgcttataatagtgaccg 36698766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 7410625 - 7410571
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||| |||||||||||||||||||||| ||| | || |||||||||||||||||||    
7410625 catatatcatttattgaatgaatctaataaa-ttaaattttgcttataatagtgac 7410571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 211 - 278
Target Start/End: Original strand, 13841917 - 13841984
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| ||| |||| ||||||||||||||||| ||||||| || ||| |||  |||||||||||||||    
13841917 atataaactacatacatcatttattgaatgaacctaaaaaggtcaatatttatttataatagtgaccg 13841984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 211 - 277
Target Start/End: Complemental strand, 13964489 - 13964424
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||||||  |||| |||||||||||||||||| | |||| ||  ||||||||||||||||||||||    
13964489 atatagaccacatacatcatttattgaatgaat-ttaaaatgttgatttttgcttataatagtgacc 13964424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 208 - 278
Target Start/End: Complemental strand, 24418954 - 24418885
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||  |||| ||||||||||||||||| || ||||||| || ||| || ||||||||||||||    
24418954 tatatatagaccacatacatcatttattgaatgaa-cttaaaaagtcaactttagcctataatagtgaccg 24418885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 129 - 278
Target Start/End: Complemental strand, 28882805 - 28882668
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcataaatc 228  Q
    ||||||||||||| |||||||||||| |  |  ||||||||| ||||||| ||| || |||||||||||         |||||||||  |  |||| |||    
28882805 ccctccggtcactattataagcaaaaatcaaccttttaggtttattcaataaatgatatatgtggtcta---------ttatatata--ccacatacatc 28882717  T
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||||||| ||||||  | ||||||| |||||||||||||    
28882716 atttattgaatgaatcta-aaaagtagacttttgctcataatagtgaccg 28882668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 1739645 - 1739701
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| || |||||||||||||| |||||||||    
1739645 catacatcattaattgaatgtatctaaaaa-gtaaatttttgcttatattagtgaccg 1739701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 211 - 284
Target Start/End: Original strand, 2627244 - 2627316
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagaga 284  Q
    |||||||||  ||| | ||||||||||||||| || ||||||| |||||||||| |||||| ||||| ||||||    
2627244 atatagactaaatacaccatttattgaatgaa-cttaaaaagttaatttttgctaataatattgaccaaagaga 2627316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 7377614 - 7377558
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| |||||||||||||||||  ||||||||    
7377614 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttataccagtgaccg 7377558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 9056081 - 9056025
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| | |||||||    
9056081 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatatttgtgaccg 9056025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 9056101 - 9056157
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| ||| |||| |||||||| |||||||||||||||||| |||||||||    
9056101 catacatcattaattaaatgtatctaaaa-agtgaatttttgcttatattagtgaccg 9056157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 10934683 - 10934739
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||| |||||||||||||||   ||| ||||||||||||||||||||||    
10934683 catacatcatttaatgaatgaatctaaaatgttga-tttttgcttataatagtgaccg 10934739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 14381298 - 14381242
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||    
14381298 catacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgaccg 14381242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 129 - 194
Target Start/End: Original strand, 28882663 - 28882728
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggt 194  Q
    ||||||||||||| |||| |||||||||  | ||||||| |||||||||| ||| || ||||||||    
28882663 ccctccggtcactattatgagcaaaagtctactttttagattcattcaataaatgatgtatgtggt 28882728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 161 - 214
Target Start/End: Original strand, 32241779 - 32241832
Alignment:
161 tttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatat 214  Q
    |||||||||||||||||| |||||| ||||||||||| ||  |||| |||||||    
32241779 tttttaggttcattcaattaattatgtatgtggtctataatatgaactatatat 32241832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 37036141 - 37036178
Alignment:
213 atagactgcataaatcatttattgaatgaatctaaaaa 250  Q
    |||||||||||| |||||||||||||||||| ||||||    
37036141 atagactgcatatatcatttattgaatgaatttaaaaa 37036178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 226 - 275
Target Start/End: Complemental strand, 37288612 - 37288563
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||| |||||||| |||||||| ||| ||||| |||||||||||||    
37288612 atcatttaatgaatgaacctaaaaaattgattttttacttataatagtga 37288563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 40098840 - 40098896
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||    
40098840 catacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgaccg 40098896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 4613643 - 4613694
Alignment:
225 aatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||||||||||||||||| | |||| || ||||||| |||||||||||||||    
4613643 aatcatttattgaatgaat-ttaaaatgtcaatttttacttataatagtgacc 4613694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 45; Significance: 2e-16; HSPs: 83)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 210 - 290
Target Start/End: Complemental strand, 10256852 - 10256773
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagagaataatt 290  Q
    |||||||||  |||| ||||||||||||||||||||| |||||||||||||| ||||||||||||| || ||||| |||||    
10256852 tatatagaccacatacatcatttattgaatgaatcta-aaaagtgaattttttcttataatagtgatcggagagagtaatt 10256773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 227 - 278
Target Start/End: Complemental strand, 5431395 - 5431345
Alignment:
227 tcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||    
5431395 tcatttattgaatgaatctaaaaa-gtgaatttttgcttataatagtgaccg 5431345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 161 - 276
Target Start/End: Original strand, 6340590 - 6340704
Alignment:
161 tttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttt 260  Q
    |||||||||||||||||| ||| || |||||||| || | | ||  ||||||||| ||  |||| ||||||||||||||||| || ||||||| ||||||    
6340590 tttttaggttcattcaataaatgatatatgtggtttatatattggtttatatataaaccacatatatcatttattgaatgaacct-aaaaagttaatttt 6340688  T
261 tgcttataatagtgac 276  Q
    ||||||||||| ||||    
6340689 tgcttataataatgac 6340704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 1409116 - 1409185
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| ||||| |||||||||||||||||||| ||||||  ||||||||||||||||||||||||    
1409116 tatacatagaccgcatacatcatttattgaatgaatct-aaaaagataatttttgcttataatagtgaccg 1409185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 217 - 278
Target Start/End: Original strand, 1035963 - 1036023
Alignment:
217 actgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||||| ||||||||||||| | |||||||||||||||||||| |||||||||    
1035963 actgcataaatcattaattgaatgaatct-agaaagtgaatttttgcttatattagtgaccg 1036023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 210 - 278
Target Start/End: Complemental strand, 38834682 - 38834615
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||  ||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||||    
38834682 tatatagactatatacatcatttatttaatgaatctaaaaaa-taaatttttgcttataatagtgaccg 38834615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 207 - 275
Target Start/End: Original strand, 39940552 - 39940619
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||||||||||| |||| || ||||||||||||||||| ||||||| ||||||| |||||||||||||    
39940552 ttatatatagactacatacattatttattgaatgaatct-aaaaagtaaatttttacttataatagtga 39940619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 284
Target Start/End: Original strand, 5431420 - 5431482
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagaga 284  Q
    |||| |||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |||||    
5431420 catacatcatttattgaatgaatct-aaaaagttaatttttgcttatattagtgaccggagaga 5431482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 280
Target Start/End: Complemental strand, 34597580 - 34597522
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||| ||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||    
34597580 catacatcatttgttgaatgaatctaaaaa-gtgaatttttgcttataatagtgatcgaa 34597522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 211 - 278
Target Start/End: Original strand, 47446701 - 47446767
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||| |||| |||||||||||||||||| | ||||||||| ||||| ||||||||||||||||    
47446701 atatagactacatacatcatttattgaatgaat-ttaaaaagtgagtttttacttataatagtgaccg 47446767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 210 - 277
Target Start/End: Complemental strand, 52112947 - 52112881
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||||  |||| |||||||||||||||||| |||||| ||||| ||||||||||||||||||||    
52112947 tatatagaccacatacatcatttattgaatgaatataaaaa-gtgaacttttgcttataatagtgacc 52112881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 131 - 278
Target Start/End: Complemental strand, 34768417 - 34768283
Alignment:
131 ctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactgcataaatcat 230  Q
    ||||||||||| |||||||||||||| || |||||||||||||||||  ||| || |||||| ||||            ||||||||||  ||| |||||    
34768417 ctccggtcactattataagcaaaagttgactttttaggttcattcaacaaataatgtatgtgatcta------------tatatagactatatacatcat 34768330  T
231 ttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| |||| |||||| ||||| ||||||||| |||||||||||    
34768329 ttattgaaagaatttaaaaa-gtgaaattttgcttacaatagtgaccg 34768283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 207 - 280
Target Start/End: Original strand, 36164023 - 36164097
Alignment:
207 ttatatatagactgcataaatcatttattgaatgaatctaaaaaa-gtgaatttttgcttataatagtgaccgaa 280  Q
    ||||||||| ||  |||| |||||||||||||||||| ||||||| || ||||||||||||||||| ||||||||    
36164023 ttatatatataccacatatatcatttattgaatgaatttaaaaaaagttaatttttgcttataataatgaccgaa 36164097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 210 - 280
Target Start/End: Original strand, 42660424 - 42660493
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||||||||  |||| |||||||||||||||| | ||||||| |||| |||||||||||||||||||||||    
42660424 tatatagaccacatacatcatttattgaatgattttaaaaaa-tgaacttttgcttataatagtgaccgaa 42660493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 52923383 - 52923327
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||||||||||||||| ||||||| ||||| |||||||||||||||||||||    
52923383 catacatcatttattgaatgaacctaaaaa-gtgaaattttgcttataatagtgaccg 52923327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 121 - 276
Target Start/End: Complemental strand, 6340719 - 6340565
Alignment:
121 attgtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtctaaaaagtgaattatatatagactg 220  Q
    |||||| | ||||| |||| | |||||||||||| |  | |||||||||||||||||| ||| || |||||||| || | |   |   ||||||| ||      
6340719 attgtatttcctcctgtcattattataagcaaaaattaactttttaggttcattcaataaatgatatatgtggtttatatataaaccaatatataaacca 6340620  T
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||| ||||||||||||||||| |||||||| ||||| ||| ||||||||||||||    
6340619 catatatcatttattgaatgaacctaaaaaa-tgaatatttacttataatagtgac 6340565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 19175668 - 19175722
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||| |||||||||||||||||||| |||||||  |||||||||||||||||||||    
19175668 catacatcatttattgaatgaatct-aaaaagtagatttttgcttataatagtgac 19175722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 124 - 191
Target Start/End: Complemental strand, 19580339 - 19580272
Alignment:
124 gtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgt 191  Q
    |||||||||||||||||| |||||| |||||||| | ||||||| |||||||||| ||| || |||||    
19580339 gtactccctccggtcactattataaacaaaagtatattttttagattcattcaataaatgatgtatgt 19580272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 229 - 283
Target Start/End: Complemental strand, 1741661 - 1741608
Alignment:
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagag 283  Q
    ||||||||||||||||||||| | |||||||||||||||| | ||||||||||||    
1741661 atttattgaatgaatctaaaaca-tgaatttttgcttatatttgtgaccgaagag 1741608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 228 - 278
Target Start/End: Complemental strand, 14214603 - 14214554
Alignment:
228 catttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||||||| ||||||| |||||||||||||||||||||||||||    
14214603 cattaattgaatgaacctaaaaa-gtgaatttttgcttataatagtgaccg 14214554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 221 - 283
Target Start/End: Complemental strand, 19175648 - 19175587
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagag 283  Q
    |||| ||||||||||||||||| ||||||| ||||| |||| |||||||||||||||| ||||    
19175648 catacatcatttattgaatgaacctaaaaa-gtgaaattttacttataatagtgaccggagag 19175587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 19580260 - 19580329
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| ||| |||| |||||||||||||||||||||||||| |  | ||||| |||||||||||||||    
19580260 tatatatacactacatacatcatttattgaatgaatctaaaaaa-tatacttttgtttataatagtgaccg 19580329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 226 - 280
Target Start/End: Complemental strand, 27939242 - 27939189
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    ||||||||||  || ||||||||||| ||||||||||||||||||||||||||||    
27939242 atcatttattatataaatctaaaaaa-tgaatttttgcttataatagtgaccgaa 27939189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 129 - 195
Target Start/End: Original strand, 52923322 - 52923388
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtc 195  Q
    ||||||||||||| |||||||||||| |  | |||||||||||||||||| ||| || |||||||||    
52923322 ccctccggtcactattataagcaaaatttcactttttaggttcattcaataaatgatgtatgtggtc 52923388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 211 - 276
Target Start/End: Original strand, 1602887 - 1602951
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    ||||||||  |||| | |||||| |||||||| |||||||| ||||||||||||||||||||||||    
1602887 atatagaccacatacaacatttaatgaatgaacctaaaaaa-tgaatttttgcttataatagtgac 1602951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 211 - 276
Target Start/End: Original strand, 2122639 - 2122703
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    ||||||||  |||| | |||||| ||||||||||||||||| || |||||||||||||||||||||    
2122639 atatagaccacatacaacatttaatgaatgaatctaaaaaa-tggatttttgcttataatagtgac 2122703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 8258023 - 8258079
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| |||||||| |||||||||||||||||| |||||||||    
8258023 catacatcattaattgaatgtatctaaaa-agtgaatttttgcttatattagtgaccg 8258079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 14214609 - 14214665
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||||||||||||||| ||||||| || | ||||||||||||||||||||||    
14214609 catacatcatttattgaatgaacctaaaaa-gtaagtttttgcttataatagtgaccg 14214665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 23944097 - 23944041
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| |||||||||| |||||||||||||||| |||||||||    
23944097 catacatcattaattgaatgtatctaaaaaa-tgaatttttgcttatattagtgaccg 23944041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 24807963 - 24808000
Alignment:
213 atagactgcataaatcatttattgaatgaatctaaaaa 250  Q
    |||||||||||| |||||||||||||||||||||||||    
24807963 atagactgcatacatcatttattgaatgaatctaaaaa 24808000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 208 - 277
Target Start/End: Complemental strand, 42915720 - 42915652
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||||||| |||  ||||||||||||||||| |||||||| | || ||||||||||| ||||||||    
42915720 tatatatagactacatgcatcatttattgaatgaacctaaaaaa-tcaacttttgcttatattagtgacc 42915652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 208 - 277
Target Start/End: Original strand, 42915713 - 42915781
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||||||  |||| |||||||||| |||||| || ||||||||  |||||||||||||||||||||    
42915713 tatatatagaccacatatatcatttatttaatgaa-cttaaaaagtgtttttttgcttataatagtgacc 42915781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 6079143 - 6079198
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| |||||||||||||||||||| |||| ||| |||||| |||||||||||||||    
6079143 catacatcatttattgaatgaatct-aaaaggtggattttttcttataatagtgacc 6079198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 52923403 - 52923458
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||| ||||||||||||||||| ||||||| ||  ||||||||||||||||||||||    
52923403 catacatcatttattgaatgaacctaaaaa-gtagatttttgcttataatagtgacc 52923458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 280
Target Start/End: Complemental strand, 1409093 - 1409051
Alignment:
237 aatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||||||||||||| ||||| |||||||||||||||||||||||    
1409093 aatgaatctaaaaa-gtgaacttttgcttataatagtgaccgaa 1409051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 268
Target Start/End: Original strand, 8984268 - 8984314
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttata 268  Q
    ||||||||||||||||||||||||||||| |  |||||||||||||||    
8984268 cataaatcatttattgaatgaatctaaaata-cgaatttttgcttata 8984314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 210 - 281
Target Start/End: Original strand, 9676035 - 9676105
Alignment:
210 tatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    ||||||||||  ||| |||||||||  ||||||||||| ||| ||| ||||| |||||||||||||||||||    
9676035 tatatagactaaatacatcatttatcaaatgaatctaagaaattga-tttttacttataatagtgaccgaag 9676105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 280
Target Start/End: Original strand, 13288414 - 13288472
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaa 280  Q
    |||| |||||||||||||| ||| || ||| ||| |||||||||||||||||||||||||    
13288414 catacatcatttattgaataaatttataaa-gtgcatttttgcttataatagtgaccgaa 13288472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 268
Target Start/End: Original strand, 34597593 - 34597639
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttata 268  Q
    |||| ||||||| |||||||||||| ||||||||||||||||||||||    
34597593 catacatcatttgttgaatgaatct-aaaaagtgaatttttgcttata 34597639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 37734847 - 37734909
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||| |||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||    
37734847 agaccgcatacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgaccg 37734909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 226 - 273
Target Start/End: Complemental strand, 42660412 - 42660366
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagt 273  Q
    |||||||||||||||||||||||||| | || ||||||||||||||||    
42660412 atcatttattgaatgaatctaaaaaa-tcaacttttgcttataatagt 42660366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 215 - 281
Target Start/End: Original strand, 2349830 - 2349896
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    ||||| |||| |||||| |||||||| |||||||||| |  |||||| |||||| ||||||||||||    
2349830 agactacatacatcattaattgaatgtatctaaaaaaatagatttttacttatattagtgaccgaag 2349896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 5431487 - 5431413
Alignment:
123 tgtactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||||| |||||||||||  ||||||||||| |  | ||||||| |||||||||| ||| || |||||||||||    
5431487 tgtactctctccggtcactaatataagcaaaaattaactttttagattcattcaataaatgatgtatgtggtcta 5431413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 208 - 282
Target Start/End: Original strand, 9902634 - 9902707
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaaga 282  Q
    |||||||| ||| |||| |||||||||||||||| | ||||||    |||||||||||||| |||||||||||||    
9902634 tatatataaactacatatatcatttattgaatgactttaaaaatca-aatttttgcttatagtagtgaccgaaga 9902707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 131 - 197
Target Start/End: Original strand, 19175589 - 19175655
Alignment:
131 ctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||||||||| ||||||| |||| |  | |||||||||||||||||| ||| || |||||||||||    
19175589 ctccggtcactattataagtaaaatttcactttttaggttcattcaataaatgatgtatgtggtcta 19175655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 215 - 277
Target Start/End: Complemental strand, 24981907 - 24981846
Alignment:
215 agactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||| |||| |||||||| |||||| ||||||||  || |||||||||||||||||||||||    
24981907 agactacatacatcatttaatgaatgtatctaaaac-gttaatttttgcttataatagtgacc 24981846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 220 - 278
Target Start/End: Original strand, 24981920 - 24981977
Alignment:
220 gcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||| |||||||||||||||   ||| ||||||||||||||||||||||    
24981920 gcatacatcatttaatgaatgaatctaaaatgttga-tttttgcttataatagtgaccg 24981977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 32796834 - 32796879
Alignment:
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||||| ||||||||||||| |||||||||||| ||||||||||||    
32796834 atttattaaatgaatctaaaa-agtgaatttttgtttataatagtga 32796879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 208 - 270
Target Start/End: Complemental strand, 36164031 - 36163970
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataat 270  Q
    |||||||| ||| |||| |||||||||||||| ||||||||||| |||| || ||||||||||    
36164031 tatatataaactacatacatcatttattgaataaatctaaaaaa-tgaaattctgcttataat 36163970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 225 - 275
Target Start/End: Complemental strand, 46412759 - 46412710
Alignment:
225 aatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||||||| ||||||||||||||| | | |||||||||||||||||||||    
46412759 aatcatttaatgaatgaatctaaaatatt-aatttttgcttataatagtga 46412710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 220 - 278
Target Start/End: Complemental strand, 46906922 - 46906865
Alignment:
220 gcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||| |||||||| ||||||||||||||| |  || ||||||||||||||||||||||    
46906922 gcatacatcatttaatgaatgaatctaaaatataga-tttttgcttataatagtgaccg 46906865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 226 - 276
Target Start/End: Complemental strand, 51022772 - 51022723
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||||||||||||||||||| | | || |||||||||||||||||||    
51022772 atcatttattgaatgaatctaaaata-tcaacttttgcttataatagtgac 51022723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 457717 - 457668
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcatt 174  Q
    |||||||||||||||| ||||||||||||| |  | ||||||||||||||    
457717 tactccctccggtcacatttataagcaaaaatgcactttttaggttcatt 457668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 639859 - 639803
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||    
639859 catacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgaccg 639803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 3384283 - 3384227
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||||||||||||||||| || ||||||    
3384283 catacatcattaattgaatgtatctaaaaa-gtgaatttttgcttatattaatgaccg 3384227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 228 - 277
Target Start/End: Original strand, 3906848 - 3906896
Alignment:
228 catttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||| ||||||||||||||| | |||||||| ||||||||||||||    
3906848 catttattaaatgaatctaaaaaa-taaatttttgtttataatagtgacc 3906896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 226 - 275
Target Start/End: Complemental strand, 6156689 - 6156641
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||||||||||||||||||| ||||||  ||||||| ||||||||||||    
6156689 atcatttattgaatgaatcta-aaaagttgatttttgtttataatagtga 6156641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 14214549 - 14214598
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    ||||||||||||| |||||||||||| |  | ||||||||||||||||||    
14214549 ccctccggtcactattataagcaaaaattcactttttaggttcattcaat 14214598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 277
Target Start/End: Original strand, 20273191 - 20273255
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    ||||||||| ||| |||||||||| ||||||| |||||||||   ||||||||||||| |||||||    
20273191 tatagactggatacatcatttattcaatgaat-taaaaaagttgttttttgcttataacagtgacc 20273255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 24807951 - 24807894
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| ||||| |||||||||||  ||||||||||  |||||||||||||||| |||||    
24807951 catacatcatatattgaatgaagttaaaaaagtgggtttttgcttataatagcgaccg 24807894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 174
Target Start/End: Original strand, 30412592 - 30412641
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcatt 174  Q
    |||||||||||||||| ||||||||||||| |  | ||||||||||||||    
30412592 tactccctccggtcacatttataagcaaaaatgcactttttaggttcatt 30412641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 33604071 - 33604127
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||    
33604071 catacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgaccg 33604127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 226 - 275
Target Start/End: Original strand, 34953981 - 34954029
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||| ||||||||||||||||| | | |||||||||||||||||||||    
34953981 atcattaattgaatgaatctaaaata-taaatttttgcttataatagtga 34954029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Original strand, 35367558 - 35367614
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| |||||||||| || ||||||||||||| |||||||||    
35367558 catacatcattaattgaatgtatctaaaaaa-tggatttttgcttatagtagtgaccg 35367614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 37734833 - 37734777
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| |||| |||| ||||||||||||||||| |||||||||    
37734833 catacatcattaattgaatgtatcttaaaa-gtgaatttttgcttatattagtgaccg 37734777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 124 - 173
Target Start/End: Complemental strand, 38758446 - 38758397
Alignment:
124 gtactccctccggtcacttttataagcaaaagtagaatttttaggttcat 173  Q
    |||||||||||||||||| ||||||||||||  | | |||||||||||||    
38758446 gtactccctccggtcactattataagcaaaaaaacactttttaggttcat 38758397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 42915642 - 42915695
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaat 178  Q
    ||||| ||| |||||||  ||||||||||||| || ||||||||||||||||||    
42915642 tactctctctggtcactaatataagcaaaagttgattttttaggttcattcaat 42915695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 48022655 - 48022599
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||| |||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||    
48022655 catacatcattaattgaatgtatctaaaaa-gtggatttttgcttatattagtgaccg 48022599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 277
Target Start/End: Complemental strand, 48083573 - 48083509
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgacc 277  Q
    |||||||  |||| |||||||| |||||||| |||||| | | |||||||||||||||||||||||    
48083573 tatagaccacatacatcatttaatgaatgaacctaaaatatt-aatttttgcttataatagtgacc 48083509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 3013695 - 3013746
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| ||||||||| |||||  || ||||||||||||||||||||||||    
3013695 atcatttaatgaatgaatgtaaaat-gttaatttttgcttataatagtgaccg 3013746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 125 - 177
Target Start/End: Original strand, 4604833 - 4604885
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaa 177  Q
    ||||| |||||||||| |||||||||||||    |||||||||||||||||||    
4604833 tactcactccggtcacatttataagcaaaaaatcaatttttaggttcattcaa 4604885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 221 - 281
Target Start/End: Original strand, 12750562 - 12750621
Alignment:
221 cataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaag 281  Q
    |||| |||||||||||||||||| | ||||||| |||||||  |||||||||| |||||||    
12750562 catacatcatttattgaatgaat-ttaaaaagtcaatttttatttataatagtaaccgaag 12750621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 18353657 - 18353708
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||| |||||||||||||||||   ||| ||||||||||||||||||||||    
18353657 atcattaattgaatgaatctaaaattatga-tttttgcttataatagtgaccg 18353708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 211 - 283
Target Start/End: Original strand, 18551331 - 18551402
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagag 283  Q
    ||||||||  |||| ||||||| |||||||||||| |||| || |||||||  |||||||||||||| |||||    
18551331 atatagaccacatacatcatttgttgaatgaatct-aaaatgttaatttttatttataatagtgaccaaagag 18551402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 227 - 275
Target Start/End: Original strand, 18854985 - 18855033
Alignment:
227 tcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    ||||||||| || |||| ||||||| || ||||||||||||||||||||    
18854985 tcatttattaaacgaatttaaaaaaatgtatttttgcttataatagtga 18855033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 23398474 - 23398423
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||| |||||||||||||||  || | ||||||||||||||||||||||    
23398474 atcatttaatgaatgaatctaaaat-gttagtttttgcttataatagtgaccg 23398423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 26158763 - 26158716
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtg 274  Q
    ||||||| ||||||||| || ||||||| ||||||||||||||||||||    
26158763 atcatttgttgaatgaa-cttaaaaagttaatttttgcttataatagtg 26158716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 26172061 - 26172014
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtg 274  Q
    ||||||| ||||||||| || ||||||| ||||||||||||||||||||    
26172061 atcatttgttgaatgaa-cttaaaaagttaatttttgcttataatagtg 26172014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 26937916 - 26937865
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||||||||||| ||||| | |||||||||||||||| | |||||||    
26937916 atcatttattgaatgaatttaaaata-tgaatttttgcttatatttgtgaccg 26937865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 27864504 - 27864555
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    ||||||||||||||||| |||||||| || ||||||  |||||||||||||||    
27864504 atcatttattgaatgaacctaaaaaattg-atttttatttataatagtgaccg 27864555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 212 - 276
Target Start/End: Complemental strand, 34953965 - 34953902
Alignment:
212 tatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgac 276  Q
    |||||||  |||| |||||||| ||||||||| ||||| | ||| ||||||||||||||||||||    
34953965 tatagaccacatacatcatttaatgaatgaatttaaaatattga-tttttgcttataatagtgac 34953902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 226 - 270
Target Start/End: Original strand, 43318093 - 43318136
Alignment:
226 atcatttattgaatgaatctaaaaaagtgaatttttgcttataat 270  Q
    |||||||||| ||||||||||||||| |||||| |||||||||||    
43318093 atcatttattaaatgaatctaaaaaa-tgaattcttgcttataat 43318136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 52112875 - 52112943
Alignment:
129 ccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggtcta 197  Q
    ||||| ||||||| ||||||||||||||  | ||||||  |||||||||| ||| || |||||||||||    
52112875 ccctcaggtcactattataagcaaaagttcactttttatattcattcaataaatgatgtatgtggtcta 52112943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 31)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 229 - 284
Target Start/End: Original strand, 32124212 - 32124266
Alignment:
229 atttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccgaagaga 284  Q
    |||||||||||||||||||||| || ||||||||||||||||| ||||||||||||    
32124212 atttattgaatgaatctaaaaa-gtcaatttttgcttataataatgaccgaagaga 32124266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 3203666 - 3203723
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaat 182  Q
    ||||||||||||||||| |||||||||||| |  | ||||||||||||||||||||||    
3203666 tactccctccggtcactattataagcaaaaatcaattttttaggttcattcaatgaat 3203723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 125 - 194
Target Start/End: Complemental strand, 31632252 - 31632183
Alignment:
125 tactccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaattatttatgtggt 194  Q
    ||||||||||||||||| ||||||| |||||| || |||||||||||||| ||| ||| || ||||||||    
31632252 tactccctccggtcactattataagtaaaagttgactttttaggttcatttaataaatgatgtatgtggt 31632183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 211 - 278
Target Start/End: Complemental strand, 3203741 - 3203675
Alignment:
211 atatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtgaccg 278  Q
    |||||||||  ||| |||||| |||||||||| |||||||| ||| ||||||||||||||||||||||    
3203741 atatagacttgatacatcattcattgaatgaacctaaaaaattga-tttttgcttataatagtgaccg 3203675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 208 - 275
Target Start/End: Original strand, 15718460 - 15718526
Alignment:
208 tatatatagactgcataaatcatttattgaatgaatctaaaaaagtgaatttttgcttataatagtga 275  Q
    |||||||| ||  |||| |||||||||||||||||| | |||| ||||||||||||||||||||||||    
15718460 tatatatacaccacatacatcatttattgaatgaattttaaaa-gtgaatttttgcttataatagtga 15718526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 128 - 183
Target Start/End: Complemental strand, 18491803 - 18491748
Alignment:
128 tccctccggtcacttttataagcaaaagtagaatttttaggttcattcaatgaatt 183  Q
    |||||||||||||| ||||||| |||||| || |||||||||||||||||| ||||    
18491803 tccctccggtcactattataagtaaaagttgactttttaggttcattcaataaatt 18491748</