View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-21 (Length: 438)

Name: J5-5-21
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-21
J5-5-21
[»] chr8 (2 HSPs)
chr8 (216-438)||(7209948-7210170)
chr8 (1-221)||(7209732-7209952)
[»] chr4 (1 HSPs)
chr4 (227-282)||(40189324-40189379)


Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 216 - 438
Target Start/End: Complemental strand, 7210170 - 7209948
Alignment:
216 attaatcttaataccttgtaacaccacggtattgagaagttctttgtccaaaagtatcaatagatttacgaggaacaggttctctagcattagattttga 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7210170 attaatcttaataccttgtaacaccacggtattgagaagttctttgtccaaaagtatcaatagatttacgaggaacaggttctctagcattagattttga 7210071  T
316 caaagaccttttcctaggatcttcattcacttgaacattagaaattgcactaccaacacccccaccaacaccattttgcacacaaggactcatagtcnaa 415  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
7210070 caaagaccttttcctaggatcttcattcacttgaacattagaaattgcactaccaacacccccaccaacaccattttgcacacaaggactcatagtcaaa 7209971  T
416 ttaagagattgaaaaccatttcc 438  Q
    |||||||||||||||||||||||    
7209970 ttaagagattgaaaaccatttcc 7209948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 7209952 - 7209732
Alignment:
1 tttccatcactggaagttgttttcccctcagaagaaaactgagtttgagtcatccaagatttatacatgctattatcatggattaaagcatgatgattgt 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7209952 tttccatcactagaagttgttttcccctcagaagaaaactgagtttgagtcatccaagatttatacatgctattatcatggattaaagcatgatgattgt 7209853  T
101 tgttgctgtgatcattatatgcatgaaaagagtgaatcaaagattggtttgttagattctcccttgtgtcaatctctggattattattggtacaaaaact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7209852 tgttgctgtgatcattatatgcatgaaaagagtgaatcaaagattggtttgttagattctcccttgtgtcaatctctggattattattggtacaaaaact 7209753  T
201 tggtgacacattaacattaat 221  Q
    |||||||||||||||||||||    
7209752 tggtgacacattaacattaat 7209732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 40189379 - 40189324
Alignment:
227 taccttgtaacaccacggtattgagaagttctttgtccaaaagtatcaatagattt 282  Q
    |||||||| ||||| |  |||||||| |||||||| ||||||||||||||||||||    
40189379 taccttgttacacctctatattgagaggttctttgaccaaaagtatcaatagattt 40189324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202286 times since January 2019
Visitors: 1515