View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-24 (Length: 529)

Name: J5-5-24
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-24
J5-5-24
[»] chr7 (3 HSPs)
chr7 (169-529)||(45943851-45944211)
chr7 (1-174)||(45943682-45943855)
chr7 (233-357)||(45037314-45037438)
[»] chr3 (1 HSPs)
chr3 (230-357)||(20395228-20395355)
[»] chr1 (2 HSPs)
chr1 (225-357)||(37686922-37687054)
chr1 (225-357)||(37698464-37698596)
[»] chr4 (1 HSPs)
chr4 (225-363)||(55222395-55222535)


Alignment Details
Target: chr7 (Bit Score: 348; Significance: 0; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 169 - 529
Target Start/End: Complemental strand, 45944211 - 45943851
Alignment:
169 attaatttttatttttattcttaatcatagtctaattgtgtaaatgttttctaaacaggactttttgaacatgtatttcaaggataaatacaagcctata 268  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45944211 attaatttttatttttattcttaatcatagtctaattgtgtaaatgttttctaaacaggactttttgaacatgtatttcaaggataaatacaagcctata 45944112  T
269 cctaatgtgtacaatcttgtgttggccatgatgtggcgtcatcctgagaatgttgagcttgagaaagttcaagttgttcactattgtgctgctgtgagat 368  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45944111 cctaatgtgtacaatcttgtgttggccatgatgtggcgtcatcctgagaatgttgagcttgagaaagttcaagttgttcactattgtgctgctgtgagat 45944012  T
369 tgctacctctgataaataactatatgttttttcatttattttataattttgtgcttaactaantataantatagcagctaatttgattatgttatattac 468  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||    
45944011 tgctacctctgataaataactatatgttttttcatttattttataattttgtgcttaactaattataattatagcagttaatttgattatgttatattac 45943912  T
469 agggctctaagccttggaggtataccggagaggaacagaacatggacngagaagacataaa 529  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
45943911 agggctctaagccttggaggtataccggagaggaacagaacatggacagagaagacataaa 45943851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 45943855 - 45943682
Alignment:
1 ataaagatgctggtgaagaaatggaaagagatatatgaagatgagacattagattacaacaacaatgtcagagtggaacgtttcacagctgctctgttag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45943855 ataaagatgctggtgaagaaatggaaagagatatatgaagatgagacattagattacaacaacaatgtcagagtggaacgtttcacagctgctctgttag 45943756  T
101 aggctggtggtctgaagtcaatgcctgcatcaaatgctgcttaatatgcttcaatggttactaattaaattaat 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45943755 aggctggtggtctgaagtcaatgcctgcatcaaatgctgcttaatatgcttcaatggttactaattaaattaat 45943682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 233 - 357
Target Start/End: Original strand, 45037314 - 45037438
Alignment:
233 ttgaacatgtatttcaaggataaatacaagcctatacctaatgtgtacaatcttgtgttggccatgatgtggcgtcatcctgagaatgttgagcttgaga 332  Q
    ||||| ||||||||||||||||  || ||||| || ||   ||| |||||||||||  | || ||| | |||||||| ||||| |||||||||||| | |    
45037314 ttgaatatgtatttcaaggatatttataagccaatcccatttgtttacaatcttgttcttgctatgttatggcgtcaccctgaaaatgttgagcttcata 45037413  T
333 aagttcaagttgttcactattgtgc 357  Q
    ||||  | |||||||||||||||||    
45037414 aagtcaaggttgttcactattgtgc 45037438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 80; Significance: 3e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 230 - 357
Target Start/End: Original strand, 20395228 - 20395355
Alignment:
230 tttttgaacatgtatttcaaggataaatacaagcctatacctaatgtgtacaatcttgtgttggccatgatgtggcgtcatcctgagaatgttgagcttg 329  Q
    |||||||| ||||||||||| |||||||| |||||||| |||||||| |||||||||||| |||||||| ||||||||||||||||||||||||| ||||    
20395228 tttttgaatatgtatttcaatgataaatataagcctatccctaatgtttacaatcttgtgctggccatgttgtggcgtcatcctgagaatgttgaacttg 20395327  T
330 agaaagttcaagttgttcactattgtgc 357  Q
    |||||||  |||||||||| || |||||    
20395328 agaaagtcaaagttgttcattactgtgc 20395355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 225 - 357
Target Start/End: Complemental strand, 37687054 - 37686922
Alignment:
225 aggactttttgaacatgtatttcaaggataaatacaagcctatacctaatgtgtacaatcttgtgttggccatgatgtggcgtcatcctgagaatgttga 324  Q
    |||| ||||||||||| |||||||| || ||||| ||||| || || ||||| || |||||||||||||||||| |||||||||| ||||||||||||||    
37687054 aggattttttgaacatatatttcaaagacaaatataagccaattccaaatgtttataatcttgtgttggccatgttgtggcgtcaccctgagaatgttga 37686955  T
325 gcttgagaaagttcaagttgttcactattgtgc 357  Q
     |||||||||||  |||||||||| || |||||    
37686954 acttgagaaagtcaaagttgttcattactgtgc 37686922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 225 - 357
Target Start/End: Original strand, 37698464 - 37698596
Alignment:
225 aggactttttgaacatgtatttcaaggataaatacaagcctatacctaatgtgtacaatcttgtgttggccatgatgtggcgtcatcctgagaatgttga 324  Q
    |||| ||||||||||| |||||||| || ||||| ||||| || || ||||| || |||||||||||||||||| |||||||||| ||||||||||||||    
37698464 aggattttttgaacatatatttcaaagacaaatataagccaattccaaatgtttataatcttgtgttggccatgttgtggcgtcaccctgagaatgttga 37698563  T
325 gcttgagaaagttcaagttgttcactattgtgc 357  Q
     |||||||||||  |||||||||| || |||||    
37698564 acttgagaaagtcaaagttgttcattactgtgc 37698596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 225 - 363
Target Start/End: Original strand, 55222395 - 55222535
Alignment:
225 aggactttttgaacatgtatttcaaggataaatacaag--cctatacctaatgtgtacaatcttgtgttggccatgatgtggcgtcatcctgagaatgtt 322  Q
    |||| |||||||||||||| ||||| || ||||| ||   || || |||||||| ||||||||||||||||||||| | |||||||  ||| ||||||||    
55222395 aggattttttgaacatgtacttcaatgacaaatataaattccaattcctaatgtttacaatcttgtgttggccatgctatggcgtccccctaagaatgtt 55222494  T
323 gagcttgagaaagttcaagttgttcactattgtgctgctgt 363  Q
    || ||||| || ||  |||||||||| || |||||||||||    
55222495 gaacttgaaaaggtcaaagttgttcattactgtgctgctgt 55222535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 305303 times since January 2019
Visitors: 438