View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-26 (Length: 239)

Name: J5-5-26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-26
J5-5-26
[»] chr7 (1 HSPs)
chr7 (1-230)||(33688814-33689043)


Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 33689043 - 33688814
Alignment:
1 atttaggcagcacatggaaatcaaatggcatgtgtaaactaaatccttatgatatagttaaagctattgtagaagaaaattgacgagttccatattttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33689043 atttaggcagcacatggaaatcaaatggcatgtgtaaactaaatccttatgatatagttaaagctattgtagaagaaaattgacgagttccatattttca 33688944  T
101 tgctccaaaatattgatatttttcttgaacatcccatgcactagttatgctttatctctttagctttgannnnnnnngggttcataatatttatgcttag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||    
33688943 tgctccaaaatattgatatttttcttgaacatcccatgcactagttatgctttatctctttagctttgattttttttgggttcataatatttatgcttag 33688844  T
201 aaattatgttatgatccttgttagattaat 230  Q
    ||||||||||||||||||||||||||||||    
33688843 aaattatgttatgatccttgttagattaat 33688814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361076 times since January 2019
Visitors: 487