View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-3 (Length: 491)

Name: J5-5-3
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-3
J5-5-3
[»] chr4 (3 HSPs)
chr4 (113-365)||(23589790-23590042)
chr4 (426-491)||(23589664-23589729)
chr4 (1-48)||(23589621-23589668)


Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 113 - 365
Target Start/End: Complemental strand, 23590042 - 23589790
Alignment:
113 taatgcttctcgtatttttgctatatgaaaacacagcagcatccacctcctattcttcatcatgacaataataaaaatgacaagattcaacagggtattt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23590042 taatgcttctcgtatttttgctatatgaaaacacagcagcatccacctcctattcttcatcatgacaataataaaaatgacaagattcaacagggtattt 23589943  T
213 ctcagatatttgaactgccatctactctatgcactgaactgaaattaccaattacagattatcaaccaggttacgaacacaatcaacaagaaagtttcag 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23589942 ctcagatatttgaactgccatctactctatgcactgaactgaaattaccaattacagattatcaaccaggttacgaacacaatcaacaagaaagtttcag 23589843  T
313 ttctcacaataacaaacatatatacttgatgcaactagctgtgaaatgggagg 365  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
23589842 ttctcacaataacaaacatatatacttgatgcaactagctgtgaaatgggagg 23589790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 426 - 491
Target Start/End: Complemental strand, 23589729 - 23589664
Alignment:
426 gacaagcttttgaggggtaagggaattgaagcatgtgtaaaacaaatggctgtagatagagtgaaa 491  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23589729 gacaagcttttgaggggtaagggaattgaagcatgtgtaaaacaaatggctgtagatagagtgaaa 23589664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 23589668 - 23589621
Alignment:
1 tgaaagaccctctctttaatggtttcgtttctatttgtactaattaat 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
23589668 tgaaagaccctctctttaatggtttcgtttctatttgtactaattaat 23589621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 305223 times since January 2019
Visitors: 438