View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5-5-30 (Length: 659)

Name: J5-5-30
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5-5-30
J5-5-30
[»] chr3 (2 HSPs)
chr3 (1-553)||(55014232-55014785)
chr3 (548-638)||(55014784-55014873)


Alignment Details
Target: chr3 (Bit Score: 542; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 542; E-Value: 0
Query Start/End: Original strand, 1 - 553
Target Start/End: Complemental strand, 55014785 - 55014232
Alignment:
1 cctacaagaacatttgggttaggatttgttgaattgaagtatattgaaccttccttgcaagcaatctgttgaggatggtccttaatagaaggtagagatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55014785 cctacaagaacatttgggttaggatttgttgaattgaagtatattgaaccttccttgcaagcaatctgttgaggatggtccttaatagaaggtagagatg 55014686  T
101 agccacggtgatgaatacgttgtggatagttgttaccataaccaaccatgtaagataaacccaaggggttatcacctaaaatgtaatcaacttgtctctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55014685 agccacggtgatgaatacgttgtggatagttgttaccataaccaaccatgtaagataaacccaaggggttatcacctaaaatgtaatcaacttgtctctt 55014586  T
201 ggcgcgctcccgaagtgtttgtgcactaacataaacattgccacaattgatggtttgtgacgtgcgggataagtatttggcgtagactaactcaaggaaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55014585 ggcgcgctcccgaagtgtttgtgcactaacataaacattgccacaattgatggtttgtgacgtgcgggataagtatttggcgtagactaactcaaggaaa 55014486  T
301 gcaattgaagttgcatgttgtaagttgcttccacctggtctgtatatgagtccaccaggagtgtactcgatgtgtgaacttgatgtttcaggtagtaatg 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55014485 gcaattgaagttgcatgttgtaagttgcttccacctggtctgtatatgagtccaccaggagtgtactcgatgtgtgaacttgatgtttcaggtagtaatg 55014386  T
401 tgcacaggaagctctctgccgaggtcttgtaagattcaagagattcaacatttccatctaggacttcctataacaacaattcatttactattgatcagca 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55014385 tgcacaggaagctctctgccgaggtcttgtaagattcaagagattcaacatttccatctaggacttcctataacaacaattcatttactattgatcagca 55014286  T
501 tttacatt-aaacaatgtcaaatatatacatttgtgcgatttccacttattaat 553  Q
    |||||||| |||||||||||||||||||||||||||||||||| ||||||||||    
55014285 tttacattaaaacaatgtcaaatatatacatttgtgcgatttcaacttattaat 55014232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 548 - 638
Target Start/End: Complemental strand, 55014873 - 55014784
Alignment:
548 attaatatatgtagttggctcaaattttctatantcagccctgncatccncttaaacatcatcnttctcnaggtcctcccacaatagctcc 638  Q
    |||||||||||||||||||||| |||||||||| ||||||||| ||||| | ||||||||||| ||||| |||||||||||||||||||||    
55014873 attaatatatgtagttggctcagattttctataatcagccctgtcatccacataaacatcatc-ttctccaggtcctcccacaatagctcc 55014784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105781 times since January 2019
Visitors: 1319